Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKRD54 cdna clone

ANKRD54 cDNA Clone

Gene Names
ANKRD54; LIAR
Synonyms
ANKRD54; ANKRD54 cDNA Clone; ANKRD54 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagccgccgccggggacgcggacgacgagccgcgctcaggccactcgagctcggagggcgagtgcgcggtggcgccggagccgctgactgacgctgagggcctcttctccttcgctgacttcgggtctgcgctgggcggcggcggcgcgggcctctcgggccgggcgtccggcggggcccagtcgccgctgcgctacttgcacgtcctgtggcagcaggatgcggagccgcgcgacgagctgcgctgcaagatacccgctggccggctgaggcgcgctgccaggccccaccggcggctcgggcccacgggcaaggaggtgcacgctctgaagagactgagggactcggccaatgccaatgatgtggaaacagtgcagcagctgctggaagatggcgcggatccctgtgcagctgatgacaagggccgcacagctctacactttgcctcatgcaatggcaatgaccagattgtgcagctgctcctggaccatggtgctgatcctaaccagcgagatgggctggggaacacgccactgcacctggcggcctgcaccaaccacgttcctgtcatcaccacactgctacgaggaggggcccgtgtagatgccctggaccgagctggtcgcacacccctgcacctggccaagtcaaagctgaatatcctgcaggagggccatgcccagtgcctagaggctgtgcgtctggaggtgaagcagatcatccatatgctgagggagtatctggagcgcctagggcaacatgagcagcgagaacgcctggatgacctctgcacccgcctgcagatgaccagtaccaaagagcaggtggatgaagtgactgacctcctggccagcttcacctccctcagtctgcagatgcagagcatggagaagaggtag
Sequence Length
903
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,254 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 54, mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 54
NCBI Official Symbol
ANKRD54
NCBI Official Synonym Symbols
LIAR
NCBI Protein Information
ankyrin repeat domain-containing protein 54
UniProt Protein Name
Ankyrin repeat domain-containing protein 54
UniProt Gene Name
ANKRD54
UniProt Synonym Gene Names
LIAR
UniProt Entry Name
ANR54_HUMAN

Uniprot Description

ANKRD54: Plays an important role in regulating intracellular signaling events associated with erythroid terminal differentiation. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytoplasm; midbody; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of erythrocyte differentiation

Research Articles on ANKRD54

Similar Products

Product Notes

The ANKRD54 ankrd54 (Catalog #AAA1272791) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagccg ccgccgggga cgcggacgac gagccgcgct caggccactc gagctcggag ggcgagtgcg cggtggcgcc ggagccgctg actgacgctg agggcctctt ctccttcgct gacttcgggt ctgcgctggg cggcggcggc gcgggcctct cgggccgggc gtccggcggg gcccagtcgc cgctgcgcta cttgcacgtc ctgtggcagc aggatgcgga gccgcgcgac gagctgcgct gcaagatacc cgctggccgg ctgaggcgcg ctgccaggcc ccaccggcgg ctcgggccca cgggcaagga ggtgcacgct ctgaagagac tgagggactc ggccaatgcc aatgatgtgg aaacagtgca gcagctgctg gaagatggcg cggatccctg tgcagctgat gacaagggcc gcacagctct acactttgcc tcatgcaatg gcaatgacca gattgtgcag ctgctcctgg accatggtgc tgatcctaac cagcgagatg ggctggggaa cacgccactg cacctggcgg cctgcaccaa ccacgttcct gtcatcacca cactgctacg aggaggggcc cgtgtagatg ccctggaccg agctggtcgc acacccctgc acctggccaa gtcaaagctg aatatcctgc aggagggcca tgcccagtgc ctagaggctg tgcgtctgga ggtgaagcag atcatccata tgctgaggga gtatctggag cgcctagggc aacatgagca gcgagaacgc ctggatgacc tctgcacccg cctgcagatg accagtacca aagagcaggt ggatgaagtg actgacctcc tggccagctt cacctccctc agtctgcaga tgcagagcat ggagaagagg tag. It is sometimes possible for the material contained within the vial of "ANKRD54, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.