ANKRD16 cdna clone
ANKRD16 cDNA Clone
Synonyms
ANKRD16; ANKRD16 cDNA Clone; ANKRD16 cdna clone
Sequence
atggcccagcccggggacccgcggcgcctctgcaggctggtgcaggagggccggctgcgcgccctgaaggaggagctgcaggcggccgggggctgcccggggccggccggggataccctcctgcactgcgccgcgcgccacgggcatcgggacgtgctggcctatctggccgaggcctggggcatggacatcgaggccaccaaccgagactacaagcggcctctgcacgaggcggcctccatgggccaccgagactgcgtgcgctacctgctgggccggggggcagcggtcgactgcctgaagaaggccgactggactcctctgatgatggcctgcacaaggaagaacctgggggtgatccaggagctggtggaacatggcgccaatccactcctgaagaacaaagatggctggaacagtttccacattgccagtcgagaaggcgaccctctgatcctccagtacctgctcactgtttgcccaggtgcctggaagacagagagcaaaattagaaggactcctctgcatactgcagcaatgcatggccatttggaggcagtcaaggtgcttcttaagaggtgccaatatgaaccagactacagagacaactgtggcgtcaccgccttgatggacgcaatccagtgtgggcacatcgacgtcgctaggctgctcctcgatgaacatggggcttgcctttcagcagaagacagcctgggtgcccaggctctgcacagggcagctgtcacagggcaggacgaagccatccgattcttggtctctgaacttggcgtcgatgtagatgtgagagccacatcaacccacctcacagcacttcattatgcagctaaggaaggacatacaagtacaattcagactctcttatccttgggagctgacatcaattctaaagatgaaaaaaatcgatcagccctgcatctggcctgtgcaggtcagcacttggcctgtgccaagtttctcctgcagtcgggactgaaggattctgaagacatcacgggcaccctggctcagcagctcccaaggagagcagatgtccttcagggctctggccatagcgcaatgacataa
Sequence Length
1086
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,447 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 16, mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 16
NCBI Official Symbol
ANKRD16
NCBI Protein Information
ankyrin repeat domain-containing protein 16
UniProt Protein Name
Ankyrin repeat domain-containing protein 16
Protein Family
UniProt Gene Name
ANKRD16
UniProt Entry Name
ANR16_HUMAN
Uniprot Description
ANKRD16: 2 isoforms of the human protein are produced by alternative splicing
Chromosomal Location of Human Ortholog: 10p15.1
Similar Products
Product Notes
The ANKRD16 ankrd16 (Catalog #AAA1269723) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagc ccggggaccc gcggcgcctc tgcaggctgg tgcaggaggg ccggctgcgc gccctgaagg aggagctgca ggcggccggg ggctgcccgg ggccggccgg ggataccctc ctgcactgcg ccgcgcgcca cgggcatcgg gacgtgctgg cctatctggc cgaggcctgg ggcatggaca tcgaggccac caaccgagac tacaagcggc ctctgcacga ggcggcctcc atgggccacc gagactgcgt gcgctacctg ctgggccggg gggcagcggt cgactgcctg aagaaggccg actggactcc tctgatgatg gcctgcacaa ggaagaacct gggggtgatc caggagctgg tggaacatgg cgccaatcca ctcctgaaga acaaagatgg ctggaacagt ttccacattg ccagtcgaga aggcgaccct ctgatcctcc agtacctgct cactgtttgc ccaggtgcct ggaagacaga gagcaaaatt agaaggactc ctctgcatac tgcagcaatg catggccatt tggaggcagt caaggtgctt cttaagaggt gccaatatga accagactac agagacaact gtggcgtcac cgccttgatg gacgcaatcc agtgtgggca catcgacgtc gctaggctgc tcctcgatga acatggggct tgcctttcag cagaagacag cctgggtgcc caggctctgc acagggcagc tgtcacaggg caggacgaag ccatccgatt cttggtctct gaacttggcg tcgatgtaga tgtgagagcc acatcaaccc acctcacagc acttcattat gcagctaagg aaggacatac aagtacaatt cagactctct tatccttggg agctgacatc aattctaaag atgaaaaaaa tcgatcagcc ctgcatctgg cctgtgcagg tcagcacttg gcctgtgcca agtttctcct gcagtcggga ctgaaggatt ctgaagacat cacgggcacc ctggctcagc agctcccaag gagagcagat gtccttcagg gctctggcca tagcgcaatg acataa. It is sometimes possible for the material contained within the vial of "ANKRD16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
