Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKRD12 cdna clone

ANKRD12 cDNA Clone

Gene Names
ANKRD12; ANCO1; GAC-1; ANCO-2; Nbla00144
Synonyms
ANKRD12; ANKRD12 cDNA Clone; ANKRD12 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaaatctgggttcacaaaaccaattcagagtgaaaattctgacagtgacagcaatatggtagagaaaccatatggaagaaagagtaaagacaagattgcatcctacagcaaaactccaaaaattgaacgaagtgatgtgagcaaggagatgaaagagaaatcatccatgaaacgtaaacttccttttactattagcccatcaagaaatgaagaacgagattcagacacagattcagatccaggacatacaagtgaaaattggggggagagacttatatcttcttacaggacatactcagagaaagaaggtccagaaaagaagaagacaaaaaaggaagctggaaataagaaatccacaccagttagcattctttttggttatccactctctgagcgaaaacagatggcacttcttatgcagatgacagcaagagacaacagtccagattccacaccaaatcatccatcacaaacaacgcctgcccaaaagaaaactcccagttcttcatctcgacagaaagataaagttaataaaagaaatgaacgtggtgaaactcctttacacatggctgctattcgaggagatgtgaaacaagttaaagaattaataagtttaggggcaaatgtgaatgtgaaagattttgcaggttggacaccactgcatgaagcttgcaatgttggatattacgatgttgctaagatacttatagcagctggagcagatgttaacacacaaggattagatgatgacactccactccatgattctgctagtagtgggcacagagatatagtaaagctgttacttcgtcacggtggaaatccatttcaagctaataaacatggggagcgtccagtggatgtagcagaaacagaggagttggagttgctactaaaaagagaggtgcctttatctgatgatgatgaaagttacacaggatccagctaccaatttgcaggaaatgccaagctcagcggagcaagttga
Sequence Length
993
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
233,012 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 12, mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 12
NCBI Official Symbol
ANKRD12
NCBI Official Synonym Symbols
ANCO1; GAC-1; ANCO-2; Nbla00144
NCBI Protein Information
ankyrin repeat domain-containing protein 12
UniProt Protein Name
Ankyrin repeat domain-containing protein 12
UniProt Gene Name
ANKRD12
UniProt Synonym Gene Names
ANCO2; KIAA0874
UniProt Entry Name
ANR12_HUMAN

NCBI Description

This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]

Uniprot Description

ANKRD12: May recruit HDACs to the p160 coactivators/nuclear receptor complex to inhibit ligand-dependent transactivation. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 18p11.22

Cellular Component: cytoplasm; nucleoplasm

Research Articles on ANKRD12

Similar Products

Product Notes

The ANKRD12 ankrd12 (Catalog #AAA1267896) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccaaat ctgggttcac aaaaccaatt cagagtgaaa attctgacag tgacagcaat atggtagaga aaccatatgg aagaaagagt aaagacaaga ttgcatccta cagcaaaact ccaaaaattg aacgaagtga tgtgagcaag gagatgaaag agaaatcatc catgaaacgt aaacttcctt ttactattag cccatcaaga aatgaagaac gagattcaga cacagattca gatccaggac atacaagtga aaattggggg gagagactta tatcttctta caggacatac tcagagaaag aaggtccaga aaagaagaag acaaaaaagg aagctggaaa taagaaatcc acaccagtta gcattctttt tggttatcca ctctctgagc gaaaacagat ggcacttctt atgcagatga cagcaagaga caacagtcca gattccacac caaatcatcc atcacaaaca acgcctgccc aaaagaaaac tcccagttct tcatctcgac agaaagataa agttaataaa agaaatgaac gtggtgaaac tcctttacac atggctgcta ttcgaggaga tgtgaaacaa gttaaagaat taataagttt aggggcaaat gtgaatgtga aagattttgc aggttggaca ccactgcatg aagcttgcaa tgttggatat tacgatgttg ctaagatact tatagcagct ggagcagatg ttaacacaca aggattagat gatgacactc cactccatga ttctgctagt agtgggcaca gagatatagt aaagctgtta cttcgtcacg gtggaaatcc atttcaagct aataaacatg gggagcgtcc agtggatgta gcagaaacag aggagttgga gttgctacta aaaagagagg tgcctttatc tgatgatgat gaaagttaca caggatccag ctaccaattt gcaggaaatg ccaagctcag cggagcaagt tga. It is sometimes possible for the material contained within the vial of "ANKRD12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.