ANKRA2 cdna clone
ANKRA2 cDNA Clone
Gene Names
ANKRA2; ANKRA
Synonyms
ANKRA2; ANKRA2 cDNA Clone; ANKRA2 cdna clone
Sequence
atggatacatcaacaaatctggatattggagcccagcttatcgtggaagagtgtcccagcacttatagcctaactggcatgccagacattaaaatagaacatccactggacccaaattcagaagaagggtcagctcagggtgttgccatgggaatgaaattcatattgcctaaccgatttgatatgaatgtgtgttctcgatttgtgaagtccttaaatgaagaagatagtaaaaatattcaagatcaggttaactctgacctggaggtggcatctgtcctatttaaagctgaatgcaatatccatacatctccttctccgggaattcaagtaaggcatgtctacaccccctctacaacaaagcatttctcacccataaaacagtcaaccactttaaccaacaaacacagaggaaatgaggtctctaccacacctctgttagcaaattctttgtctgttcaccagttggctgctcagggagagatgctctatctggctactcgtatcgaacaagaaaatgttatcaatcacacggatgaagaaggatttactcctctgatgtgggctgcagcacacgggcaaatagctgtggtagagttcctacttcagaatggtgctgatccccaacttttaggaaaaggtcgagaaagtgcactgtcgttggcctgtagtaaaggctacacagatattgtcaaaatgctgcttgattgtggagttgatgtaaatgaatatgattggaatggaggaacacctctgctttatgctgtacatggaaatcatgtgaaatgtgtaaagatgctcttagaaagtggggctgatccaacaattgaaactgactctggatataattctatggatctagctgtagccctaggctatagaagtgttcaacaggttattgagtcacatttgttgaagctgcttcaaaatatcaaggagtag
Sequence Length
942
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,272 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat, family A (RFXANK-like), 2, mRNA
NCBI Official Synonym Full Names
ankyrin repeat family A member 2
NCBI Official Symbol
ANKRA2
NCBI Official Synonym Symbols
ANKRA
NCBI Protein Information
ankyrin repeat family A protein 2
UniProt Protein Name
Ankyrin repeat family A protein 2
Protein Family
UniProt Gene Name
ANKRA2
UniProt Synonym Gene Names
ANKRA
UniProt Entry Name
ANRA2_HUMAN
Uniprot Description
ANKRA2: May facilitate endocytosis by linking megalin to components of the cytoskeleton or endocytic machinery.
Protein type: Cytoskeletal
Chromosomal Location of Human Ortholog: 5q12-q13
Cellular Component: cytosol; membrane; nucleus
Molecular Function: low-density lipoprotein binding; protein binding; transcription cofactor activity
Biological Process: regulation of transcription from RNA polymerase II promoter
Research Articles on ANKRA2
Similar Products
Product Notes
The ANKRA2 ankra2 (Catalog #AAA1270199) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatacat caacaaatct ggatattgga gcccagctta tcgtggaaga gtgtcccagc acttatagcc taactggcat gccagacatt aaaatagaac atccactgga cccaaattca gaagaagggt cagctcaggg tgttgccatg ggaatgaaat tcatattgcc taaccgattt gatatgaatg tgtgttctcg atttgtgaag tccttaaatg aagaagatag taaaaatatt caagatcagg ttaactctga cctggaggtg gcatctgtcc tatttaaagc tgaatgcaat atccatacat ctccttctcc gggaattcaa gtaaggcatg tctacacccc ctctacaaca aagcatttct cacccataaa acagtcaacc actttaacca acaaacacag aggaaatgag gtctctacca cacctctgtt agcaaattct ttgtctgttc accagttggc tgctcaggga gagatgctct atctggctac tcgtatcgaa caagaaaatg ttatcaatca cacggatgaa gaaggattta ctcctctgat gtgggctgca gcacacgggc aaatagctgt ggtagagttc ctacttcaga atggtgctga tccccaactt ttaggaaaag gtcgagaaag tgcactgtcg ttggcctgta gtaaaggcta cacagatatt gtcaaaatgc tgcttgattg tggagttgat gtaaatgaat atgattggaa tggaggaaca cctctgcttt atgctgtaca tggaaatcat gtgaaatgtg taaagatgct cttagaaagt ggggctgatc caacaattga aactgactct ggatataatt ctatggatct agctgtagcc ctaggctata gaagtgttca acaggttatt gagtcacatt tgttgaagct gcttcaaaat atcaaggagt ag. It is sometimes possible for the material contained within the vial of "ANKRA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
