Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKHD1 cdna clone

ANKHD1 cDNA Clone

Gene Names
ANKHD1; MASK; MASK1; VBARP; PP2500
Synonyms
ANKHD1; ANKHD1 cDNA Clone; ANKHD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgtgaattcctctaaatacccctcactgctccttcattcccaagaagaaaagacaagtactgctacttccaaaactcagacacgacttgaaggtgaagtgactcctaattccttgtcaaccagctacaagacagtgtcattgccattaagctctccaaacataaagctgaatctcactagccctaaaaggggtcagaaaatagaagaagggtggaaagaagttgtacgaaggtcaaagaaattgtctgttccagcctcagtggtgtcgaggataatgggaagaggaggatgcaacatcactgcaatacaggatgttactggtgcccatattgatgtggataaacaaaaagataagaatggcgagagaatgatcacaataaggggtggcacagaatcaacaagatatgcagttcaactaatcaatgcactcattcaagatcctgctaaggaactggaagacttgattcctaaaaatcatatcagaacacctgccagcaccaaatcaattcatgctaacttctcatctggagtaggtaccacagcagcttccagtaaaaatgcatttcctttgggtgctccaactcttgtaacttcacaggcaacaacgttatctacgttccagcccgctaataaacttaataagaatgttccaacaaatgtacgttcttctttcccagtttctctacccttagcttatcctcaccctcattttgccctgctggctgctcaaactatgcaacagattcggcatcctcgcttacccatggcccagtttggaggaaccttctcaccttctcctaacacatggggaccattcccagtgagacctgtgaatcctggcaacacaaatagctctccaaagcataataacacaagccgtctacctaaccagaacgggactgttttaccctcagagtctgctggactagctactgccagttgtcctatcactgtctcttctgtagttgctgccagtcagcaactgtgtgtcactaatacccggactccttcatcagtcagaaagcagttgtttgcctgtgtgcctaagacaagtcctccagcaacagtgatttcttctgtgacaagcacttgtagttccctgccttctgtctcctctgcacctatcactagcgggcaagctcccaccacatttctacctgcaagtacttctcaagcacagctttcttcacaaaagatggagtctttctctgctgtgccacccaccaaagagaaagtgtccacacaggaccagcccatggcaaacctatgtaccccatcttcaactgcaaacagttgcagtagctctgccagcaacaccccgggagctccagaaactcacccatccagtagtcccactcctacttccagtaacacacaagaggaggcacagccatccagtgtgtctgatttaagtcctatgtcaatgccttttgcatctaactcagaacctgctccattgactttgacatcacccagaatggttgctgctgataatcaggacaccagtaatttacctcagttagctgtaccagcacctcgagtttctcatcgaatgcagcccagaggttctttttactccatggtaccaaatgcaactattcaccaggatccccagtctatttttgttacgaatccagttactttaacaccacctcaaggcccaccagctgcagtgcagctttcttcagctgtgaacattatgaatggttctcagatgcacataaacccagcaaataagtctttgccacctacatttggcccagccacacttttcaatcacttcagcagtctttttgatagtagtcaggtgccagctaaccagggctggggagatggtccactgtcctcacgagttgctacagatgcctctttcactgttcagtcagcgttcctgggtaactcagtgcttggacacttggaaaacatgcaccctgataactcaaaggcacctggcttcagaccaccttcccagcgagtttctactagtccagttgccacttctgccccaccaacgttgggccaaccaaaaggagtcagtgccagtcaagatcgaaagatacctcccccaattggaacagagagactggcccgaattcggcaaggagggtctgttgcacaagccccggcggggaccagttttgtcgctcccgttggacacagtggaatctggtcatttggtgtcaatgctgtgtcagaaggcttatcaggttggtcgcaatctgtgatggggaaccatccaatgcatcaacaattatcagacccaagcacattctcccaacatcagccaatggagagagatgattctggaatggtagccccctctaacatttttcatcagcctatggcaagtggttttgtggatttttctaaaggtctgccaatttccatgtatggaggcaccataataccctctcatcctcagcttgctgatgttccaggaggccctctgtttaatggacttcacaatccagatcctgcttggaaccctatgataaaagttatccaaaattcaactgaatgcactgatgcccagcagatttggcctggcacgtgggcacctcatattggaaacatgcatctcaaatatgtcaactaa
Sequence Length
2601
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
277,175 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and KH domain containing 1, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and KH domain containing 1
NCBI Official Symbol
ANKHD1
NCBI Official Synonym Symbols
MASK; MASK1; VBARP; PP2500
NCBI Protein Information
ankyrin repeat and KH domain-containing protein 1
UniProt Protein Name
Ankyrin repeat and KH domain-containing protein 1
UniProt Gene Name
ANKHD1
UniProt Synonym Gene Names
KIAA1085; MASK; VBARP; hMASK
UniProt Entry Name
ANKH1_HUMAN

NCBI Description

This gene encodes a protein with multiple ankyrin repeat domains and a single KH-domain. The protein is thought to function as a scaffolding protein, and it may be involved in the regulation of caspases and thereby play an antiapoptotic role in cell survival. Alternative splicing results in multiple transcript variants, one of which generates a fusion transcript (MASK-BP3) with the downstream eIF4E-binding protein 3 (EIF4EBP3) gene, resulting in a protein comprised of the ANKHD1 sequence for the majority of the protein and a different C-terminus due to an alternate reading frame for the EIF4EBP3 segments. [provided by RefSeq, Sep 2010]

Uniprot Description

ANKHD1: May play a role as a scaffolding protein that may be associated with the abnormal phenotype of leukemia cells. Isoform 2 may possess an antiapoptotic effect and protect cells during normal cell survival through its regulation of caspases. Belongs to the mask family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; RNA-binding

Chromosomal Location of Human Ortholog: 5q31.3

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: protein binding

Biological Process: innate immune response

Research Articles on ANKHD1

Similar Products

Product Notes

The ANKHD1 ankhd1 (Catalog #AAA1271537) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgtga attcctctaa atacccctca ctgctccttc attcccaaga agaaaagaca agtactgcta cttccaaaac tcagacacga cttgaaggtg aagtgactcc taattccttg tcaaccagct acaagacagt gtcattgcca ttaagctctc caaacataaa gctgaatctc actagcccta aaaggggtca gaaaatagaa gaagggtgga aagaagttgt acgaaggtca aagaaattgt ctgttccagc ctcagtggtg tcgaggataa tgggaagagg aggatgcaac atcactgcaa tacaggatgt tactggtgcc catattgatg tggataaaca aaaagataag aatggcgaga gaatgatcac aataaggggt ggcacagaat caacaagata tgcagttcaa ctaatcaatg cactcattca agatcctgct aaggaactgg aagacttgat tcctaaaaat catatcagaa cacctgccag caccaaatca attcatgcta acttctcatc tggagtaggt accacagcag cttccagtaa aaatgcattt cctttgggtg ctccaactct tgtaacttca caggcaacaa cgttatctac gttccagccc gctaataaac ttaataagaa tgttccaaca aatgtacgtt cttctttccc agtttctcta cccttagctt atcctcaccc tcattttgcc ctgctggctg ctcaaactat gcaacagatt cggcatcctc gcttacccat ggcccagttt ggaggaacct tctcaccttc tcctaacaca tggggaccat tcccagtgag acctgtgaat cctggcaaca caaatagctc tccaaagcat aataacacaa gccgtctacc taaccagaac gggactgttt taccctcaga gtctgctgga ctagctactg ccagttgtcc tatcactgtc tcttctgtag ttgctgccag tcagcaactg tgtgtcacta atacccggac tccttcatca gtcagaaagc agttgtttgc ctgtgtgcct aagacaagtc ctccagcaac agtgatttct tctgtgacaa gcacttgtag ttccctgcct tctgtctcct ctgcacctat cactagcggg caagctccca ccacatttct acctgcaagt acttctcaag cacagctttc ttcacaaaag atggagtctt tctctgctgt gccacccacc aaagagaaag tgtccacaca ggaccagccc atggcaaacc tatgtacccc atcttcaact gcaaacagtt gcagtagctc tgccagcaac accccgggag ctccagaaac tcacccatcc agtagtccca ctcctacttc cagtaacaca caagaggagg cacagccatc cagtgtgtct gatttaagtc ctatgtcaat gccttttgca tctaactcag aacctgctcc attgactttg acatcaccca gaatggttgc tgctgataat caggacacca gtaatttacc tcagttagct gtaccagcac ctcgagtttc tcatcgaatg cagcccagag gttcttttta ctccatggta ccaaatgcaa ctattcacca ggatccccag tctatttttg ttacgaatcc agttacttta acaccacctc aaggcccacc agctgcagtg cagctttctt cagctgtgaa cattatgaat ggttctcaga tgcacataaa cccagcaaat aagtctttgc cacctacatt tggcccagcc acacttttca atcacttcag cagtcttttt gatagtagtc aggtgccagc taaccagggc tggggagatg gtccactgtc ctcacgagtt gctacagatg cctctttcac tgttcagtca gcgttcctgg gtaactcagt gcttggacac ttggaaaaca tgcaccctga taactcaaag gcacctggct tcagaccacc ttcccagcga gtttctacta gtccagttgc cacttctgcc ccaccaacgt tgggccaacc aaaaggagtc agtgccagtc aagatcgaaa gatacctccc ccaattggaa cagagagact ggcccgaatt cggcaaggag ggtctgttgc acaagccccg gcggggacca gttttgtcgc tcccgttgga cacagtggaa tctggtcatt tggtgtcaat gctgtgtcag aaggcttatc aggttggtcg caatctgtga tggggaacca tccaatgcat caacaattat cagacccaag cacattctcc caacatcagc caatggagag agatgattct ggaatggtag ccccctctaa catttttcat cagcctatgg caagtggttt tgtggatttt tctaaaggtc tgccaatttc catgtatgga ggcaccataa taccctctca tcctcagctt gctgatgttc caggaggccc tctgtttaat ggacttcaca atccagatcc tgcttggaac cctatgataa aagttatcca aaattcaact gaatgcactg atgcccagca gatttggcct ggcacgtggg cacctcatat tggaaacatg catctcaaat atgtcaacta a. It is sometimes possible for the material contained within the vial of "ANKHD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.