Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANGPTL4 cdna clone

ANGPTL4 cDNA Clone

Gene Names
ANGPTL4; NL2; ARP4; FIAF; HARP; PGAR; HFARP; TGQTL; UNQ171; pp1158
Synonyms
ANGPTL4; ANGPTL4 cDNA Clone; ANGPTL4 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcggtgctccgacggccggggcagccctgatgctctgcgccgccaccgccgtgctactgagcgctcagggcggacccgtgcagtccaagtcgccgcgctttgcgtcctgggacgagatgaatgtcctggcgcacggactcctgcagctcggccaggggctgcgcgaacacgcggagcgcacccgcagtcagctgagcgcgctggagcggcgcctgagcgcgtgcgggtccgcctgtcagggaaccgaggggtccaccgacctcccgttagcccctgagagccgggtggaccctgaggtccttcacagcctgcagacacaactcaaggctcagaacagcaggatccagcaactcttccacaaggtggcccagcagcagcggcacctggagaagcagcacctgcgaattcagcatctgcaaagccagtttggcctcctggaccacaagcacctagaccatgaggtggccaagcctgcccgaagaaagaggctgcccgagatggcccagccagttgacccggctcacaatgtcagccgcctgcaccggctgcccagggattgccaggagctgttccaggttggggagaggcagagtggactatttgaaatccagcctcaggggtctccgccatttttggtgaactgcaagatgacctcagatggaggctggacagtaattcagaggcgccacgatggctcagtggacttcaaccggccctgggaagcctacaaggcggggtttggggatccccacggcgagttctggctgggtctggagaaggtgcatagcatcacgggggaccgcaacagccgcctggccgtgcagctgcgggactgggatggcaacgccgagttgctgcagttctccgtgcacctgggtggcgaggacacggcctatagcctgcagctcactgcacccgtggccggccagctgggcgccaccaccgtcccacccagcggcctctccgtacccttctccacttgggaccaggatcacgacctccgcagggacaagaactgcgccaagagcctctctggaggctggtggtttggcacctgcagccattccaacctcaacggccagtacttccgctccatcccacagcagcggcagaagcttaagaagggaatcttctggaagacctggcggggccgctactacccactgcaggccaccaccatgttgatccagcccatggcagcagaggcagcctcctag
Sequence Length
1221
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,853 Da
NCBI Official Full Name
Homo sapiens angiopoietin-like 4, mRNA
NCBI Official Synonym Full Names
angiopoietin like 4
NCBI Official Symbol
ANGPTL4
NCBI Official Synonym Symbols
NL2; ARP4; FIAF; HARP; PGAR; HFARP; TGQTL; UNQ171; pp1158
NCBI Protein Information
angiopoietin-related protein 4
UniProt Protein Name
Angiopoietin-related protein 4
UniProt Gene Name
ANGPTL4
UniProt Synonym Gene Names
ARP4; HFARP; PGAR; HFARP
UniProt Entry Name
ANGL4_HUMAN

NCBI Description

This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]

Uniprot Description

ANGPTL4: Protein with hypoxia-induced expression in endothelial cells. May act as a regulator of angiogenesis and modulate tumorigenesis. Inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. May exert a protective function on endothelial cells through an endocrine action. It is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

Protein type: Secreted; Extracellular matrix; Apoptosis; Inhibitor; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: extracellular region; extracellular space

Molecular Function: enzyme inhibitor activity; identical protein binding; protein binding

Biological Process: negative regulation of apoptosis; negative regulation of lipoprotein lipase activity; positive regulation of angiogenesis

Disease: Plasma Triglyceride Level Quantitative Trait Locus

Research Articles on ANGPTL4

Similar Products

Product Notes

The ANGPTL4 angptl4 (Catalog #AAA1277090) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcggtg ctccgacggc cggggcagcc ctgatgctct gcgccgccac cgccgtgcta ctgagcgctc agggcggacc cgtgcagtcc aagtcgccgc gctttgcgtc ctgggacgag atgaatgtcc tggcgcacgg actcctgcag ctcggccagg ggctgcgcga acacgcggag cgcacccgca gtcagctgag cgcgctggag cggcgcctga gcgcgtgcgg gtccgcctgt cagggaaccg aggggtccac cgacctcccg ttagcccctg agagccgggt ggaccctgag gtccttcaca gcctgcagac acaactcaag gctcagaaca gcaggatcca gcaactcttc cacaaggtgg cccagcagca gcggcacctg gagaagcagc acctgcgaat tcagcatctg caaagccagt ttggcctcct ggaccacaag cacctagacc atgaggtggc caagcctgcc cgaagaaaga ggctgcccga gatggcccag ccagttgacc cggctcacaa tgtcagccgc ctgcaccggc tgcccaggga ttgccaggag ctgttccagg ttggggagag gcagagtgga ctatttgaaa tccagcctca ggggtctccg ccatttttgg tgaactgcaa gatgacctca gatggaggct ggacagtaat tcagaggcgc cacgatggct cagtggactt caaccggccc tgggaagcct acaaggcggg gtttggggat ccccacggcg agttctggct gggtctggag aaggtgcata gcatcacggg ggaccgcaac agccgcctgg ccgtgcagct gcgggactgg gatggcaacg ccgagttgct gcagttctcc gtgcacctgg gtggcgagga cacggcctat agcctgcagc tcactgcacc cgtggccggc cagctgggcg ccaccaccgt cccacccagc ggcctctccg tacccttctc cacttgggac caggatcacg acctccgcag ggacaagaac tgcgccaaga gcctctctgg aggctggtgg tttggcacct gcagccattc caacctcaac ggccagtact tccgctccat cccacagcag cggcagaagc ttaagaaggg aatcttctgg aagacctggc ggggccgcta ctacccactg caggccacca ccatgttgat ccagcccatg gcagcagagg cagcctccta g. It is sometimes possible for the material contained within the vial of "ANGPTL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.