AMY2B cdna clone
AMY2B cDNA Clone
Gene Names
AMY2B; HXA; AMY2; AMY3
Synonyms
AMY2B; AMY2B cDNA Clone; AMY2B cdna clone
Sequence
atgaagttctttctgttgcttttcaccattgggttctgctgggctcagtattccccaaatacacaacaaggacggacatctattgttcatctgtttgaatggcgatgggttgatattgctcttgaatgtgagcgatatttagctcccaagggatttggaggggttcaggtctctccaccaaatgaaaatgttgcaattcacaaccctttcagaccttggtgggaaagataccaaccagttagctataaattatgcacaagatctggaaatgaagatgaatttagaaacatggtgactagatgtaacaatgttggggttcgtatttatgtggatgctgtaattaatcatatgtctggtaatgctgtgagtgcaggaacaagcagtacctgtggaagttacttcaaccctggaagtagggactttccagcagtcccatattctggatgggattttaatgatggtaaatgtaaaactggaagtggagatatcgagaactacaatgatgctactcaggtcagagattgtcgtctggttggtcttcttgatcttgcactggagaaagattatgtgcgttccaagattgccgaatatatgaatcatctcattgacattggtgttgcagggttcagacttgatgcttccaagcacatgtggcctggagacataaaggcaattttggacaaactgcataatctaaacagtaactggttccctgcaggaagtaaacctttcatttaccaggaggtaattgatctgggtggtgagccaattaaaagcagtgactactttggaaatggccgggtgacagaattcaagtatggtgcaaaactcggcacagttattcgcaagtggaatggagagaagatgtcttacctaaagaactggggagaaggttggggtttcatgccttctgacagagcacttgtctttgtggataaccatgacaatcaacgaggacatggggctggaggagcctctattcttaccttctgggatgctaggctgtataaaatggcagttggatttatgcttgctcatccttatggttttacacgagtaatgtcaagctaccgttggccaagacagtttcaaaatggaaacgatgttaatgattgggttgggccaccaaataataatggagtaattaaagaagttactattaatccagacactacttgtggcaatgactgggtctgtgaacatcgatggcgccaaataaggaacatggttaatttccgcaatgtagtggatggccagccttttacaaactggtatgataatgggagcaaccaagtggcttttgggagaggaaacagaggattcattgttttcaacaatgatgactggacattttctttaactttgcaaactggtcttcctgctggcacatactgtgatgtcatttctggagataaaattaatggcaattgcacaggcattaaaatctacgtttctgacgatggcaaagctcatttttctattagtaactctgctgaggatccatttattgcaattcatgctgaatctaaattataa
Sequence Length
1536
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,021 Da
NCBI Official Full Name
Homo sapiens amylase, alpha 2B (pancreatic), mRNA
NCBI Official Synonym Full Names
amylase, alpha 2B (pancreatic)
NCBI Official Symbol
AMY2B
NCBI Official Synonym Symbols
HXA; AMY2; AMY3
NCBI Protein Information
alpha-amylase 2B
UniProt Protein Name
Alpha-amylase 2B
Protein Family
UniProt Gene Name
AMY2B
UniProt Entry Name
AMY2B_HUMAN
NCBI Description
Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jun 2013]
Uniprot Description
AMY2B: Monomer. Belongs to the glycosyl hydrolase 13 family.
Protein type: Secreted, signal peptide; Hydrolase; Secreted; Carbohydrate Metabolism - starch and sucrose; EC 3.2.1.1
Chromosomal Location of Human Ortholog: 1p21
Biological Process: digestion
Research Articles on AMY2B
Similar Products
Product Notes
The AMY2B amy2b (Catalog #AAA1271697) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagttct ttctgttgct tttcaccatt gggttctgct gggctcagta ttccccaaat acacaacaag gacggacatc tattgttcat ctgtttgaat ggcgatgggt tgatattgct cttgaatgtg agcgatattt agctcccaag ggatttggag gggttcaggt ctctccacca aatgaaaatg ttgcaattca caaccctttc agaccttggt gggaaagata ccaaccagtt agctataaat tatgcacaag atctggaaat gaagatgaat ttagaaacat ggtgactaga tgtaacaatg ttggggttcg tatttatgtg gatgctgtaa ttaatcatat gtctggtaat gctgtgagtg caggaacaag cagtacctgt ggaagttact tcaaccctgg aagtagggac tttccagcag tcccatattc tggatgggat tttaatgatg gtaaatgtaa aactggaagt ggagatatcg agaactacaa tgatgctact caggtcagag attgtcgtct ggttggtctt cttgatcttg cactggagaa agattatgtg cgttccaaga ttgccgaata tatgaatcat ctcattgaca ttggtgttgc agggttcaga cttgatgctt ccaagcacat gtggcctgga gacataaagg caattttgga caaactgcat aatctaaaca gtaactggtt ccctgcagga agtaaacctt tcatttacca ggaggtaatt gatctgggtg gtgagccaat taaaagcagt gactactttg gaaatggccg ggtgacagaa ttcaagtatg gtgcaaaact cggcacagtt attcgcaagt ggaatggaga gaagatgtct tacctaaaga actggggaga aggttggggt ttcatgcctt ctgacagagc acttgtcttt gtggataacc atgacaatca acgaggacat ggggctggag gagcctctat tcttaccttc tgggatgcta ggctgtataa aatggcagtt ggatttatgc ttgctcatcc ttatggtttt acacgagtaa tgtcaagcta ccgttggcca agacagtttc aaaatggaaa cgatgttaat gattgggttg ggccaccaaa taataatgga gtaattaaag aagttactat taatccagac actacttgtg gcaatgactg ggtctgtgaa catcgatggc gccaaataag gaacatggtt aatttccgca atgtagtgga tggccagcct tttacaaact ggtatgataa tgggagcaac caagtggctt ttgggagagg aaacagagga ttcattgttt tcaacaatga tgactggaca ttttctttaa ctttgcaaac tggtcttcct gctggcacat actgtgatgt catttctgga gataaaatta atggcaattg cacaggcatt aaaatctacg tttctgacga tggcaaagct catttttcta ttagtaactc tgctgaggat ccatttattg caattcatgc tgaatctaaa ttataa. It is sometimes possible for the material contained within the vial of "AMY2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
