Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALG9 cdna clone

ALG9 cDNA Clone

Gene Names
ALG9; CDG1L; DIBD1; GIKANIS; LOH11CR1J
Synonyms
ALG9; ALG9 cDNA Clone; ALG9 cdna clone
Ordering
For Research Use Only!
Sequence
atggctagtcgaggggctcggcagcgcctgaagggcagcggggccagcagtggggatacggccccggctgcggacaagctgcgggagctgctgggcagccgagaggcgggcggcgcggagcaccggaccgagttatctgggaacaaagcaggacaagtctgggcacctgaaggatctactgctttcaagtgtctgctttcagcaaggttatgtgctgctctcctgagcaacatctctgactgtgatgaaacattcaactactgggagccaacacactacctcatctatggggaagggtttcagacttgggaatattccccagcatatgccattcgctcctatgcttacctgttgcttcatgcctggccagctgcatttcatgcaagaattctacaaactaataagattcttgtgttttactttttgcgatgtcttctggcttttgtgagctgtatttgtgaactttacttttacaaggctgtgtgcaagaagtttgggttgcacgtgagtcgaatgatgctagccttcttggttctcagcactggcatgttttgctcatcatcagcattccttcctagtagcttctgtatgtacactacgttgatagccatgactggatggtatatggacaagacttccattgctgtgctgggagtagcagctggggctatcttaggctggccattcagtgcagctcttggtttacccattgcctttgatttgctggtcatgaaacacaggtggaagagtttctttcattggtcgctgatggccctcatactatttctggtgcctgtggtggtcattgacagctactattatgggaagttggtgattgcaccactcaacattgttttgtataatgtctttactcctcatggacctgatctttatggtacagaaccctggtatttctatttaattaatggatttctgaatttcaatgtagcctttgctttggctctcctagtcctaccactgacttctcttatggaatacctgctgcagagatttcatgttcagaatttaggccacccgtattggcttaccttggctccaatgtatatttggtttataattttcttcatccagcctcacaaagaggagagatttcttttccctgtgtatccacttatatgtctctgtggcgctgtggctctctctgcacttcagcacagttttctgtacttccagaaatgttaccactttgtgtttcaacgatatcgcctggagcactatactgtgacatcgaattggctggcattaggaactgtcttcctgtttgggctcttgtcattttctcgctctgtggcactgttcagaggatatcacgggccccttgatttgtatccagaattttaccgaattgctacagacccaaccatccacactgtcccagaaggcagacctgtgaatgtctgtgtgggaaaagagtggtatcgatttcccagcagcttccttcttcctgacaattggcagcttcagttcattccatcagagttcagaggtcagttaccaaaaccttttgcagaaggacctctggccacccggattgttcctactgacatgaatgaccagaatctagaagagccatccagatatattgatatcagtaaatgccattatttagtggatttggacaccatgagagaaacaccccgggagccaaaatattcatccaataaagaagaatggatcagcttggcctatagaccattccttgatgcttctagatcttcaaagctgctgcgggcattctatgtccccttcctgtcagatcagtatacagtgtacgtaaactacaccatcctcaaaccccggaaagcaaagcaaatcaggaagaaaagtggaggttag
Sequence Length
1857
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,743 Da
NCBI Official Full Name
Homo sapiens asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
ALG9, alpha-1,2-mannosyltransferase
NCBI Official Symbol
ALG9
NCBI Official Synonym Symbols
CDG1L; DIBD1; GIKANIS; LOH11CR1J
NCBI Protein Information
alpha-1,2-mannosyltransferase ALG9
UniProt Protein Name
Alpha-1,2-mannosyltransferase ALG9
UniProt Gene Name
ALG9
UniProt Synonym Gene Names
DIBD1
UniProt Entry Name
ALG9_HUMAN

NCBI Description

This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Uniprot Description

ALG9: Catalyzes the transfer of mannose from Dol-P-Man to lipid-linked oligosaccharides. A chromosomal aberration involving ALG9 is found in a family with bipolar affective disorder. Translocation t(9;11)(p24;q23). However, common variations in ALG9 do not play a major role in predisposition to bipolar affective disorder. Defects in ALG9 are the cause of congenital disorder of glycosylation type 1L (CDG1L). CDGs are a family of severe inherited diseases caused by a defect in protein N- glycosylation. They are characterized by under-glycosylated serum proteins. These multisystem disorders present with a wide variety of clinical features, such as disorders of the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. Belongs to the glycosyltransferase 22 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; Glycan Metabolism - N-glycan biosynthesis; EC 2.4.1.259; EC 2.4.1.261; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane

Molecular Function: alpha-1,2-mannosyltransferase activity; mannosyltransferase activity

Biological Process: dolichol-linked oligosaccharide biosynthetic process

Disease: Congenital Disorder Of Glycosylation, Type Il; Gillessen-kaesbach-nishimura Syndrome

Research Articles on ALG9

Similar Products

Product Notes

The ALG9 alg9 (Catalog #AAA1273534) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagtc gaggggctcg gcagcgcctg aagggcagcg gggccagcag tggggatacg gccccggctg cggacaagct gcgggagctg ctgggcagcc gagaggcggg cggcgcggag caccggaccg agttatctgg gaacaaagca ggacaagtct gggcacctga aggatctact gctttcaagt gtctgctttc agcaaggtta tgtgctgctc tcctgagcaa catctctgac tgtgatgaaa cattcaacta ctgggagcca acacactacc tcatctatgg ggaagggttt cagacttggg aatattcccc agcatatgcc attcgctcct atgcttacct gttgcttcat gcctggccag ctgcatttca tgcaagaatt ctacaaacta ataagattct tgtgttttac tttttgcgat gtcttctggc ttttgtgagc tgtatttgtg aactttactt ttacaaggct gtgtgcaaga agtttgggtt gcacgtgagt cgaatgatgc tagccttctt ggttctcagc actggcatgt tttgctcatc atcagcattc cttcctagta gcttctgtat gtacactacg ttgatagcca tgactggatg gtatatggac aagacttcca ttgctgtgct gggagtagca gctggggcta tcttaggctg gccattcagt gcagctcttg gtttacccat tgcctttgat ttgctggtca tgaaacacag gtggaagagt ttctttcatt ggtcgctgat ggccctcata ctatttctgg tgcctgtggt ggtcattgac agctactatt atgggaagtt ggtgattgca ccactcaaca ttgttttgta taatgtcttt actcctcatg gacctgatct ttatggtaca gaaccctggt atttctattt aattaatgga tttctgaatt tcaatgtagc ctttgctttg gctctcctag tcctaccact gacttctctt atggaatacc tgctgcagag atttcatgtt cagaatttag gccacccgta ttggcttacc ttggctccaa tgtatatttg gtttataatt ttcttcatcc agcctcacaa agaggagaga tttcttttcc ctgtgtatcc acttatatgt ctctgtggcg ctgtggctct ctctgcactt cagcacagtt ttctgtactt ccagaaatgt taccactttg tgtttcaacg atatcgcctg gagcactata ctgtgacatc gaattggctg gcattaggaa ctgtcttcct gtttgggctc ttgtcatttt ctcgctctgt ggcactgttc agaggatatc acgggcccct tgatttgtat ccagaatttt accgaattgc tacagaccca accatccaca ctgtcccaga aggcagacct gtgaatgtct gtgtgggaaa agagtggtat cgatttccca gcagcttcct tcttcctgac aattggcagc ttcagttcat tccatcagag ttcagaggtc agttaccaaa accttttgca gaaggacctc tggccacccg gattgttcct actgacatga atgaccagaa tctagaagag ccatccagat atattgatat cagtaaatgc cattatttag tggatttgga caccatgaga gaaacacccc gggagccaaa atattcatcc aataaagaag aatggatcag cttggcctat agaccattcc ttgatgcttc tagatcttca aagctgctgc gggcattcta tgtccccttc ctgtcagatc agtatacagt gtacgtaaac tacaccatcc tcaaaccccg gaaagcaaag caaatcagga agaaaagtgg aggttag. It is sometimes possible for the material contained within the vial of "ALG9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.