Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALG2 cdna clone

ALG2 cDNA Clone

Gene Names
ALG2; CDGIi; CMS14; NET38; CMSTA3; hALPG2
Synonyms
ALG2; ALG2 cDNA Clone; ALG2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaggagcagggccgggaacgggactcggttcccaagccgtcggtgctgttcctccacccagacctgggcgtgggcggcgctgagcggctggtgttggacgcggcgctggcgctgcaggcgcgcgggtgtagcgtgaagatctggacagcgcactacgacccgggccactgtttcgccgagagccgcgagctaccggtgcgctgtgccggggactggctgccgcgaggcctgggctggggcggccgcggcgccgccgtctgcgcctacgtgcgcatggttttcctggcgctctacgtgctgttcctcgccgacgaggagttcgacgtggtagtgtgcgaccaggtgtctgcctgtatcccagtgttcaggctggctagacggcggaagaagatcctattttactgtcacttcccagatctgcttctcaccaagagagattcttttcttaaacgactatacagggccccaattgactggatagaggaatacaccacaggcatggcagactgcatcttagtcaacagccagttcacagctgctgtttttaaggaaacattcaagtccctgtctcacatagaccctgatgtcctctatccatctctaaatgtcaccagctttgactcagttgttcctgaaaagctggatgacctagtccccaaggggaaaaaattcctgctgctctccatcaacagatacgaaaggaagaaaaatctgactttggcactggaagccctagtacagctgcgtggaagattgacatcccaagattgggagagggttcatctgatcgtggcaggtggttatgacgagagagtcctggagaatgtggaacattatcaggaattgaagaaaatggtccaacagtccgaccttggccagtatgtgaccttcttgaggtctttctcagacaaacagaaaatctccctcctccacagctgcacgtgtgtgctttacacaccaagcaatgagcactttggcattgtccctctggaagccatgtacatgcagtgcccagtcattgctgttaattcgggtggacccttggagtccattgaccacagtgtcacagggtttctgtgtgagcctgacccggtgcacttctcagaagcaatagaaaagttcatccgtgaaccttccttaaaagccaccatgggcctggctggaagagccagagtgaaggaaaaattttcccctgaagcatttacagaacagctctaccgatatgttaccaaactgctggtataa
Sequence Length
1251
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,017 Da
NCBI Official Full Name
Homo sapiens asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
ALG2, alpha-1,3/1,6-mannosyltransferase
NCBI Official Symbol
ALG2
NCBI Official Synonym Symbols
CDGIi; CMS14; NET38; CMSTA3; hALPG2
NCBI Protein Information
alpha-1,3/1,6-mannosyltransferase ALG2
UniProt Protein Name
Alpha-1,3/1,6-mannosyltransferase ALG2
UniProt Gene Name
ALG2
UniProt Entry Name
ALG2_HUMAN

NCBI Description

This gene encodes a member of the glycosyltransferase 1 family. The encoded protein acts as an alpha 1,3 mannosyltransferase, mannosylating Man(2)GlcNAc(2)-dolichol diphosphate and Man(1)GlcNAc(2)-dolichol diphosphate to form Man(3)GlcNAc(2)-dolichol diphosphate. Defects in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ii). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]

Uniprot Description

ALG2: Mannosylates Man(2)GlcNAc(2)-dolichol diphosphate and Man(1)GlcNAc(2)-dolichol diphosphate to form Man(3)GlcNAc(2)- dolichol diphosphate. Defects in ALG2 are the cause of congenital disorder of glycosylation type 1I (CDG1I). CDGs are a family of severe inherited diseases caused by a defect in protein N- glycosylation. They are characterized by under-glycosylated serum proteins. These multisystem disorders present with a wide variety of clinical features, such as disorders of the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. Belongs to the glycosyltransferase group 1 family. Glycosyltransferase 4 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Glycan Metabolism - N-glycan biosynthesis; EC 2.4.1.257; Transferase; EC 2.4.1.132

Chromosomal Location of Human Ortholog: 9q22.33

Cellular Component: cytoplasm; endoplasmic reticulum membrane; membrane; nucleus; perinuclear region of cytoplasm

Molecular Function: alpha-1,3-mannosyltransferase activity; calcium-dependent protein binding; protein binding; protein heterodimerization activity; protein N-terminus binding

Biological Process: dolichol-linked oligosaccharide biosynthetic process; protein amino acid glycosylation in endoplasmic reticulum; response to calcium ion

Disease: Congenital Disorder Of Glycosylation, Type Ii; Myasthenic Syndrome, Congenital, With Tubular Aggregates 3

Research Articles on ALG2

Similar Products

Product Notes

The ALG2 alg2 (Catalog #AAA1267164) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg agcagggccg ggaacgggac tcggttccca agccgtcggt gctgttcctc cacccagacc tgggcgtggg cggcgctgag cggctggtgt tggacgcggc gctggcgctg caggcgcgcg ggtgtagcgt gaagatctgg acagcgcact acgacccggg ccactgtttc gccgagagcc gcgagctacc ggtgcgctgt gccggggact ggctgccgcg aggcctgggc tggggcggcc gcggcgccgc cgtctgcgcc tacgtgcgca tggttttcct ggcgctctac gtgctgttcc tcgccgacga ggagttcgac gtggtagtgt gcgaccaggt gtctgcctgt atcccagtgt tcaggctggc tagacggcgg aagaagatcc tattttactg tcacttccca gatctgcttc tcaccaagag agattctttt cttaaacgac tatacagggc cccaattgac tggatagagg aatacaccac aggcatggca gactgcatct tagtcaacag ccagttcaca gctgctgttt ttaaggaaac attcaagtcc ctgtctcaca tagaccctga tgtcctctat ccatctctaa atgtcaccag ctttgactca gttgttcctg aaaagctgga tgacctagtc cccaagggga aaaaattcct gctgctctcc atcaacagat acgaaaggaa gaaaaatctg actttggcac tggaagccct agtacagctg cgtggaagat tgacatccca agattgggag agggttcatc tgatcgtggc aggtggttat gacgagagag tcctggagaa tgtggaacat tatcaggaat tgaagaaaat ggtccaacag tccgaccttg gccagtatgt gaccttcttg aggtctttct cagacaaaca gaaaatctcc ctcctccaca gctgcacgtg tgtgctttac acaccaagca atgagcactt tggcattgtc cctctggaag ccatgtacat gcagtgccca gtcattgctg ttaattcggg tggacccttg gagtccattg accacagtgt cacagggttt ctgtgtgagc ctgacccggt gcacttctca gaagcaatag aaaagttcat ccgtgaacct tccttaaaag ccaccatggg cctggctgga agagccagag tgaaggaaaa attttcccct gaagcattta cagaacagct ctaccgatat gttaccaaac tgctggtata a. It is sometimes possible for the material contained within the vial of "ALG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.