Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALG14 cdna clone

ALG14 cDNA Clone

Gene Names
ALG14; CMS15
Synonyms
ALG14; ALG14 cDNA Clone; ALG14 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgtgcgttctcgttctagctgcggccgcaggagctgtggcggttttcctaatcctgcgaatatgggtagtgcttcgttccatggacgttacgccccgggagtctctcagtatcttggtagtggctgggtccggtgggcataccactgagatcctgaggctgcttgggagcttgtccaatgcctactcacctagacattatgtcattgctgacactgatgaaatgagtgccaataaaataaattcttttgaactagatcgagctgatagagaccctagtaacatgtataccaaatactacattcaccgaattccaagaagccgggaggttcagcagtcctggccctccaccgttttcaccaccttgcactccatgtggctctcctttcccctaattcacagggtgaagccagatttggtgttgtgtaacggaccaggaacatgtgttcctatctgtgtatctgcccttctccttgggatactaggaataaagaaagtgatcattgtctacgttgaaagcatctgccgtgtagaaacgttatccatgtccggaaagattctgtttcatctctcagattacttcattgttcagtggccggctctgaaagaaaagtatcccaaatcggtgtaccttgggcgaattgtttga
Sequence Length
651
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,151 Da
NCBI Official Full Name
Homo sapiens asparagine-linked glycosylation 14 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
ALG14, UDP-N-acetylglucosaminyltransferase subunit
NCBI Official Symbol
ALG14
NCBI Official Synonym Symbols
CMS15
NCBI Protein Information
UDP-N-acetylglucosamine transferase subunit ALG14 homolog
UniProt Protein Name
UDP-N-acetylglucosamine transferase subunit ALG14 homolog
UniProt Gene Name
ALG14
UniProt Entry Name
ALG14_HUMAN

NCBI Description

This gene is a member of the glycosyltransferase 1 family. The encoded protein and ALG13 are thought to be subunits of UDP-GlcNAc transferase, which catalyzes the first two committed steps in endoplasmic reticulum N-linked glycosylation. Mutations in this gene have been linked to congenital myasthenic syndrome (CMSWTA). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]

Uniprot Description

ALG14: May be involved in protein N-glycosylation. May play a role in the second step of the dolichol-linked oligosaccharide pathway. May anchor the catalytic subunit ALG13 to the ER. Belongs to the ALG14 family.

Protein type: Membrane protein, integral; Glycan Metabolism - N-glycan biosynthesis

Chromosomal Location of Human Ortholog: 1p21.3

Cellular Component: endoplasmic reticulum membrane

Molecular Function: N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity

Biological Process: dolichol-linked oligosaccharide biosynthetic process

Disease: Myasthenic Syndrome, Congenital, Without Tubular Aggregates

Research Articles on ALG14

Similar Products

Product Notes

The ALG14 alg14 (Catalog #AAA1269473) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgtgcg ttctcgttct agctgcggcc gcaggagctg tggcggtttt cctaatcctg cgaatatggg tagtgcttcg ttccatggac gttacgcccc gggagtctct cagtatcttg gtagtggctg ggtccggtgg gcataccact gagatcctga ggctgcttgg gagcttgtcc aatgcctact cacctagaca ttatgtcatt gctgacactg atgaaatgag tgccaataaa ataaattctt ttgaactaga tcgagctgat agagacccta gtaacatgta taccaaatac tacattcacc gaattccaag aagccgggag gttcagcagt cctggccctc caccgttttc accaccttgc actccatgtg gctctccttt cccctaattc acagggtgaa gccagatttg gtgttgtgta acggaccagg aacatgtgtt cctatctgtg tatctgccct tctccttggg atactaggaa taaagaaagt gatcattgtc tacgttgaaa gcatctgccg tgtagaaacg ttatccatgt ccggaaagat tctgtttcat ctctcagatt acttcattgt tcagtggccg gctctgaaag aaaagtatcc caaatcggtg taccttgggc gaattgtttg a. It is sometimes possible for the material contained within the vial of "ALG14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.