Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALB cdna clone

ALB cDNA Clone

Gene Names
ALB; HSA; PRO0883; PRO0903; PRO1341
Synonyms
ALB; ALB cDNA Clone; ALB cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtccatttgaagatcatgtaaaattagtgaatgaagtaactgaatttgcaaaaacatgtgttgctgatgagtcagctgaaaattgtgacaaatcacttcataccctttttggagacaaattatgcacagttgcaactcttcgtgaaacctatggtgaaatggctgactgctgtgcaaaacaagaacctgagagaaatgaatgcttcttgcaacacaaagatgacaacccaaacctcccccgattggtgagaccagaggttgatgtgatgtgcactgcttttcatgacaatgaagagacatttttgaaaaaatacttatatgaaattgccagaagacatccttacttttatgccccggaactccttttctttgctaaaaggtataaagctgcttttacagaatgttgccaagctgctgataaagctgcctgcctgttgccaaagctcgatgaacttcgggatgaagggaaggcttcgtctgccaaacagagactcaagtgtgccagtctccaaaaatttggagaaagagctttcaaagcatgggcagtagctcgcctgagccagagatttcccaaagctgagtttgcagaagtttccaagttagtgacagatcttaccaaagtccacacggaatgctgccatggagatctgcttgaatgtgctgatgacagggcggaccttgccaagtatatctgtgaaaatcaagattcgatctccagtaaactgaaggaatgctgtgaaaaacctctgttggaaaaatcccactgcattgccgaagtggaaaatgatgagatgcctgctgacttgccttcattagctgctgattttgttgaaagtaaggatgtttgcaaaaactatgctgaggcaaaggatgtcttcctgggcatgtttttgtatgaatatgcaagaaggcatcctgattactctgtcgtgctgctgctgagacttgccaagacatatgaaaccactctagagaagtgctgtgccgctgcagatcctcatgaatgctatgccaaagtgttcgatgaatttaaacctcttgtggaagagcctcagaatttaatcaaacaaaattgtgagctttttgagcagcttggagagtacaaattccagaatgcgctattagttcgttacaccaagaaagtaccccaagtgtcaactccaactcttgtagaggtctcaagaaacctaggaaaagtgggcagcaaatgttgtaaacatcctgaagcaaaaagaatgccctgtgcagaagactatctatccgtggtcctgaaccagttatgtgtgttgcatgagaaaacgccagtaagtgacagagtcaccaaatgctgcacagaatccttggtgaacaggcgaccatgcttttcagctctggaagtcgatgaaacatacgttcccaaagagtttaatgctgaaacattcaccttccatgcagatatatgcacactttctgagaaggagagacaaatcaagaaacaaactgcacttgttgagcttgtgaaacacaagcccaaggcaacaaaagagcaactgaaagctgttatggatgatttcgcagcttttgtagagaagtgctgcaaggctgacgataaggagacctgctttgccgaggagggtaaaaaaacttgttgctgcaagtcaagctgccttaggcttataacatcacatttaaaagcatctcagcctaccatgagaataagagaaagaaaatga
Sequence Length
1884
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
213
Molecular Weight
45,160 Da
NCBI Official Full Name
Homo sapiens albumin, mRNA
NCBI Official Synonym Full Names
albumin
NCBI Official Symbol
ALB
NCBI Official Synonym Symbols
HSA; PRO0883; PRO0903; PRO1341
NCBI Protein Information
serum albumin
UniProt Protein Name
Serum albumin
Protein Family
UniProt Gene Name
ALB
UniProt Entry Name
ALBU_HUMAN

NCBI Description

This gene encodes the most abundant protein in human blood. This protein functions in the regulation of blood plasma colloid osmotic pressure and acts as a carrier protein for a wide range of endogenous molecules including hormones, fatty acids, and metabolites, as well as exogenous drugs. Additionally, this protein exhibits an esterase-like activity with broad substrate specificity. The encoded preproprotein is proteolytically processed to generate the mature protein. A peptide derived from this protein, EPI-X4, is an endogenous inhibitor of the CXCR4 chemokine receptor. [provided by RefSeq, Jul 2016]

Uniprot Description

albumin: Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloidal osmotic pressure of blood. Major zinc transporter in plasma, typically binds about 80% of all plasma zinc. Plasma. Belongs to the ALB/AFP/VDB family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Carrier; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: endoplasmic reticulum; extracellular region; extracellular space; Golgi apparatus; nucleus; protein complex

Molecular Function: chaperone binding; DNA binding; drug binding; fatty acid binding; identical protein binding; oxygen binding; protein binding; pyridoxal phosphate binding; toxin binding

Biological Process: bile acid and bile salt transport; cellular response to starvation; hemolysis by symbiont of host red blood cells; lipoprotein metabolic process; maintenance of mitochondrion localization; negative regulation of apoptosis; platelet degranulation; receptor-mediated endocytosis; retinal homeostasis; sodium-independent organic anion transport; transport

Disease: Analbuminemia; Hyperthyroxinemia, Familial Dysalbuminemic

Research Articles on ALB

Similar Products

Product Notes

The ALB alb (Catalog #AAA1278192) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtggg taacctttat ttcccttctt tttctcttta gctcggctta ttccaggggt gtgtttcgtc gagatgcaca caagagtgag gttgctcatc ggtttaaaga tttgggagaa gaaaatttca aagccttggt gttgattgcc tttgctcagt atcttcagca gtgtccattt gaagatcatg taaaattagt gaatgaagta actgaatttg caaaaacatg tgttgctgat gagtcagctg aaaattgtga caaatcactt catacccttt ttggagacaa attatgcaca gttgcaactc ttcgtgaaac ctatggtgaa atggctgact gctgtgcaaa acaagaacct gagagaaatg aatgcttctt gcaacacaaa gatgacaacc caaacctccc ccgattggtg agaccagagg ttgatgtgat gtgcactgct tttcatgaca atgaagagac atttttgaaa aaatacttat atgaaattgc cagaagacat ccttactttt atgccccgga actccttttc tttgctaaaa ggtataaagc tgcttttaca gaatgttgcc aagctgctga taaagctgcc tgcctgttgc caaagctcga tgaacttcgg gatgaaggga aggcttcgtc tgccaaacag agactcaagt gtgccagtct ccaaaaattt ggagaaagag ctttcaaagc atgggcagta gctcgcctga gccagagatt tcccaaagct gagtttgcag aagtttccaa gttagtgaca gatcttacca aagtccacac ggaatgctgc catggagatc tgcttgaatg tgctgatgac agggcggacc ttgccaagta tatctgtgaa aatcaagatt cgatctccag taaactgaag gaatgctgtg aaaaacctct gttggaaaaa tcccactgca ttgccgaagt ggaaaatgat gagatgcctg ctgacttgcc ttcattagct gctgattttg ttgaaagtaa ggatgtttgc aaaaactatg ctgaggcaaa ggatgtcttc ctgggcatgt ttttgtatga atatgcaaga aggcatcctg attactctgt cgtgctgctg ctgagacttg ccaagacata tgaaaccact ctagagaagt gctgtgccgc tgcagatcct catgaatgct atgccaaagt gttcgatgaa tttaaacctc ttgtggaaga gcctcagaat ttaatcaaac aaaattgtga gctttttgag cagcttggag agtacaaatt ccagaatgcg ctattagttc gttacaccaa gaaagtaccc caagtgtcaa ctccaactct tgtagaggtc tcaagaaacc taggaaaagt gggcagcaaa tgttgtaaac atcctgaagc aaaaagaatg ccctgtgcag aagactatct atccgtggtc ctgaaccagt tatgtgtgtt gcatgagaaa acgccagtaa gtgacagagt caccaaatgc tgcacagaat ccttggtgaa caggcgacca tgcttttcag ctctggaagt cgatgaaaca tacgttccca aagagtttaa tgctgaaaca ttcaccttcc atgcagatat atgcacactt tctgagaagg agagacaaat caagaaacaa actgcacttg ttgagcttgt gaaacacaag cccaaggcaa caaaagagca actgaaagct gttatggatg atttcgcagc ttttgtagag aagtgctgca aggctgacga taaggagacc tgctttgccg aggagggtaa aaaaacttgt tgctgcaagt caagctgcct taggcttata acatcacatt taaaagcatc tcagcctacc atgagaataa gagaaagaaa atga. It is sometimes possible for the material contained within the vial of "ALB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.