Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AKR7A2 cdna clone

AKR7A2 cDNA Clone

Gene Names
AKR7A2; AFAR; AKR7; AFAR1; AFB1-AR1
Synonyms
AKR7A2; AKR7A2 cDNA Clone; AKR7A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccggccaccgccaccgcgggtcgcctcggtgctgggcaccatggagatggggcgccgcatggacgcgcccgccagcgccgcggccgtgcgcgcctttctggagcgcggccacaccgaactggacacggccttcatgtacagcgacggccagtccgagaccatcctgggcggcctggggctcgggctgggcggtggcgactgcagagtgaaaattgccaccaaggccaacccttgggatggaaaatcactaaagcctgacagtgtccggtcccagctggagacgtcattgaagaggctgcagtgtccccaagtggacctcttctacctacacgcacctgaccacggcaccccggtggaagagacgctgcatgcctgccagcggctgcaccaggagggcaagttcgtggagcttggcctctccaactatgctagctgggaagtggccgagatctgtaccctctgcaagagcaatggctggatcctgcccactgtgtaccagggcatgtacaacgccaccacccggcaggtggaaacggagctcttcccctgcctcaggcactttggactgaggttctatgcctacaaccctctggctgggggcctgctgactggcaagtacaagtatgaggacaaggacgggaaacagcctgtgggccgcttctttgggaatagctgggctgagacctacaggaatcgcttctggaaggagcaccacttcgaggccattgcgttggtggagaaggccctgcaggccgcatatggcgccagcgcccccagtgtgacctcggctgccctccggtggatgtaccaccactcacagctgcagggtgcccacggggacgcggtcatcctgggcatgtccagcctggagcagctggagcagaacttggcagcaacagaggaagggcccctggagccggctgtcgtggatgcctttaatcaagcctggcatttggttgctcacgaatgtcccaactacttccgctag
Sequence Length
993
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,589 Da
NCBI Official Full Name
Homo sapiens aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase), mRNA
NCBI Official Synonym Full Names
aldo-keto reductase family 7 member A2
NCBI Official Symbol
AKR7A2
NCBI Official Synonym Symbols
AFAR; AKR7; AFAR1; AFB1-AR1
NCBI Protein Information
aflatoxin B1 aldehyde reductase member 2
UniProt Protein Name
Aflatoxin B1 aldehyde reductase member 2
UniProt Gene Name
AKR7A2
UniProt Synonym Gene Names
AFAR; AFAR1; AKR7; AFB1-AR 1; SSA reductase
UniProt Entry Name
ARK72_HUMAN

NCBI Description

The protein encoded by this gene belongs to the aldo/keto reductase (AKR) superfamily and AKR7 family, which are involved in the detoxification of aldehydes and ketones. The AKR7 family consists of 3 genes that are present in a cluster on the p arm of chromosome 1. This protein, thought to be localized in the golgi, catalyzes the NADPH-dependent reduction of succinic semialdehyde to the endogenous neuromodulator, gamma-hydroxybutyrate. It may also function as a detoxication enzyme in the reduction of aflatoxin B1 and 2-carboxybenzaldehyde. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

AKR7A2: Catalyzes the NADPH-dependent reduction of succinic semialdehyde to gamma-hydroxybutyrate. May have an important role in producing the neuromodulator gamma-hydroxybutyrate (GHB). Has broad substrate specificity. Has NADPH-dependent aldehyde reductase activity towards 2-carboxybenzaldehyde, 2- nitrobenzaldehyde and pyridine-2-aldehyde (in vitro). Can reduce 1,2-naphthoquinone and 9,10-phenanthrenequinone (in vitro). Can reduce the dialdehyde protein-binding form of aflatoxin B1 (AFB1) to the non-binding AFB1 dialcohol. May be involved in protection of liver against the toxic and carcinogenic effects of AFB1, a potent hepatocarcinogen. Belongs to the aldo/keto reductase family. Aldo/keto reductase 2 subfamily.

Protein type: EC 1.1.1.n11; Oxidoreductase

Chromosomal Location of Human Ortholog: 1p36.13

Cellular Component: cytosol

Molecular Function: aldehyde reductase activity; aldo-keto reductase activity; electron carrier activity; phenanthrene-9,10-epoxide hydrolase activity

Biological Process: aldehyde metabolic process; carbohydrate metabolic process; xenobiotic metabolic process

Research Articles on AKR7A2

Similar Products

Product Notes

The AKR7A2 akr7a2 (Catalog #AAA1271172) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccggc caccgccacc gcgggtcgcc tcggtgctgg gcaccatgga gatggggcgc cgcatggacg cgcccgccag cgccgcggcc gtgcgcgcct ttctggagcg cggccacacc gaactggaca cggccttcat gtacagcgac ggccagtccg agaccatcct gggcggcctg gggctcgggc tgggcggtgg cgactgcaga gtgaaaattg ccaccaaggc caacccttgg gatggaaaat cactaaagcc tgacagtgtc cggtcccagc tggagacgtc attgaagagg ctgcagtgtc cccaagtgga cctcttctac ctacacgcac ctgaccacgg caccccggtg gaagagacgc tgcatgcctg ccagcggctg caccaggagg gcaagttcgt ggagcttggc ctctccaact atgctagctg ggaagtggcc gagatctgta ccctctgcaa gagcaatggc tggatcctgc ccactgtgta ccagggcatg tacaacgcca ccacccggca ggtggaaacg gagctcttcc cctgcctcag gcactttgga ctgaggttct atgcctacaa ccctctggct gggggcctgc tgactggcaa gtacaagtat gaggacaagg acgggaaaca gcctgtgggc cgcttctttg ggaatagctg ggctgagacc tacaggaatc gcttctggaa ggagcaccac ttcgaggcca ttgcgttggt ggagaaggcc ctgcaggccg catatggcgc cagcgccccc agtgtgacct cggctgccct ccggtggatg taccaccact cacagctgca gggtgcccac ggggacgcgg tcatcctggg catgtccagc ctggagcagc tggagcagaa cttggcagca acagaggaag ggcccctgga gccggctgtc gtggatgcct ttaatcaagc ctggcatttg gttgctcacg aatgtcccaa ctacttccgc tag. It is sometimes possible for the material contained within the vial of "AKR7A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.