Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AIF1 cdna clone

AIF1 cDNA Clone

Gene Names
AIF1; IBA1; IRT1; AIF-1; IRT-1
Synonyms
AIF1; AIF1 cDNA Clone; AIF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccaaaccagggatttacagggaggaaaagctttcggactgctgaaggcccagcaggaagagaggctggatgagatcaacaagcaattcctagacgatcccaaatatagcagtgatgaggatctgccctccaaactggaaggcttcaaagagaaatacatggagtttgaccttaatggaaatggcgatattgatatcatgtccctgaaacgaatgctggagaaacttggagtccccaagactcacctagagctaaagaaattaattggagaggtgtccagtggctccggggagacgttcagctaccctgactttctcaggatgatgctgggcaagagatctgccatcctaaaaatgatcctgatgtatgaggaaaaagcgagagaaaaggaaaagccaacaggccccccagccaagaaagctatctctgagttgccctga
Sequence Length
444
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
199
Molecular Weight
14,617 Da
NCBI Official Full Name
Homo sapiens allograft inflammatory factor 1, mRNA
NCBI Official Synonym Full Names
allograft inflammatory factor 1
NCBI Official Symbol
AIF1
NCBI Official Synonym Symbols
IBA1; IRT1; AIF-1; IRT-1
NCBI Protein Information
allograft inflammatory factor 1
UniProt Protein Name
Allograft inflammatory factor 1
Protein Family
UniProt Gene Name
AIF1
UniProt Synonym Gene Names
G1; IBA1; AIF-1
UniProt Entry Name
AIF1_HUMAN

NCBI Description

This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]

Uniprot Description

AIF1: Actin-binding protein that enhances membrane ruffling and RAC activation. Enhances the actin-bundling activity of LCP1. Binds calcium. Plays a role in RAC signaling and in phagocytosis. May play a role in macrophage activation and function. Promotes the proliferation of vascular smooth muscle cells and of T- lymphocytes. Enhances lymphocyte migration. Plays a role in vascular inflammation. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: actin filament; cytoplasm; cytosol; lamellipodium; nucleus; perinuclear region of cytoplasm; phagocytic cup

Molecular Function: actin filament binding; calcium ion binding

Biological Process: actin filament bundle formation; actin filament polymerization; inflammatory response; negative regulation of smooth muscle cell proliferation; phagocytosis, engulfment; positive regulation of smooth muscle cell proliferation; positive regulation of T cell proliferation; Rac protein signal transduction

Research Articles on AIF1

Similar Products

Product Notes

The AIF1 aif1 (Catalog #AAA1273921) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccaaa ccagggattt acagggagga aaagctttcg gactgctgaa ggcccagcag gaagagaggc tggatgagat caacaagcaa ttcctagacg atcccaaata tagcagtgat gaggatctgc cctccaaact ggaaggcttc aaagagaaat acatggagtt tgaccttaat ggaaatggcg atattgatat catgtccctg aaacgaatgc tggagaaact tggagtcccc aagactcacc tagagctaaa gaaattaatt ggagaggtgt ccagtggctc cggggagacg ttcagctacc ctgactttct caggatgatg ctgggcaaga gatctgccat cctaaaaatg atcctgatgt atgaggaaaa agcgagagaa aaggaaaagc caacaggccc cccagccaag aaagctatct ctgagttgcc ctga. It is sometimes possible for the material contained within the vial of "AIF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.