AIDA cdna clone
AIDA cDNA Clone
Gene Names
AIDA; C1orf80
Synonyms
AIDA; AIDA cDNA Clone; AIDA cdna clone
Sequence
atgtcggaggtgacccggagtctgctgcagcgctggggcgccagttttaggagaggcgccgacttcgactcttggggccagctggtggaggcgatagacgagtatcagatattagcaagacatctacaaaaggaggcccaagctcaacacaataattctgaattcacagaagaacaaaagaaaaccataggcaaaattgcaacatgcttggaattgcgaagtgcagctttacagtccacacagtctcaagaagaatttaaactggaggacctgaagaagctagaaccaatcctaaagaatattcttacatataataaagaattcccatttgatgttcagcctgtcccattaagaagaattttggcacctggtgaagaagagaatttggaatttgaagaagatgaagaagagggtggtgctggagcagggtctcctgattcttttcctgctagagttcccggtactttattaccaaggttgccatcggaaccaggaatgacattactcactatcagaattgagaaaattggtttgaaagatgctgggcagtgcatcgatccctatattacagttagtgtaaaggatctgaatggcatagacttaactcctgtgcaagatactcctgtggcttcaagaaaagaagatacatatgttcattttaatgtggacattgagctccagaagcatgttgaaaaattaaccaaaggtgcagctatcttctttgaattcaaacactacaagcctaaaaaaaggtttaccagcaccaagtgttttgctttcatggagatggatgaaattaaacctgggccaattgtaatagaactatacaagaaacccactgactttaaaagaaagaaattgcaattattgaccaagaaaccactttatcttcatctacatcaaactttgcacaaggaatga
Sequence Length
921
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,914 Da
NCBI Official Full Name
Homo sapiens axin interactor, dorsalization associated, mRNA
NCBI Official Synonym Full Names
axin interactor, dorsalization associated
NCBI Official Symbol
AIDA
NCBI Official Synonym Symbols
C1orf80
NCBI Protein Information
axin interactor, dorsalization-associated protein
UniProt Protein Name
Axin interactor, dorsalization-associated protein
Protein Family
UniProt Gene Name
AIDA
UniProt Synonym Gene Names
C1orf80
UniProt Entry Name
AIDA_HUMAN
Uniprot Description
AIDA: Acts as a ventralizing factor during embryogenesis. Inhibits axin-mediated JNK activation by binding axin and disrupting axin homodimerization. This in turn antagonizes a Wnt/beta-catenin-independent dorsalization pathway activated by AXIN/JNK-signaling. Belongs to the AIDA family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell development/differentiation
Chromosomal Location of Human Ortholog: 1q41
Cellular Component: membrane
Molecular Function: phosphoinositide binding; protein binding
Biological Process: determination of ventral identity; dorsal/ventral pattern formation; negative regulation of JNK activity; negative regulation of JNK cascade; regulation of protein homodimerization activity
Similar Products
Product Notes
The AIDA aida (Catalog #AAA1268688) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggagg tgacccggag tctgctgcag cgctggggcg ccagttttag gagaggcgcc gacttcgact cttggggcca gctggtggag gcgatagacg agtatcagat attagcaaga catctacaaa aggaggccca agctcaacac aataattctg aattcacaga agaacaaaag aaaaccatag gcaaaattgc aacatgcttg gaattgcgaa gtgcagcttt acagtccaca cagtctcaag aagaatttaa actggaggac ctgaagaagc tagaaccaat cctaaagaat attcttacat ataataaaga attcccattt gatgttcagc ctgtcccatt aagaagaatt ttggcacctg gtgaagaaga gaatttggaa tttgaagaag atgaagaaga gggtggtgct ggagcagggt ctcctgattc ttttcctgct agagttcccg gtactttatt accaaggttg ccatcggaac caggaatgac attactcact atcagaattg agaaaattgg tttgaaagat gctgggcagt gcatcgatcc ctatattaca gttagtgtaa aggatctgaa tggcatagac ttaactcctg tgcaagatac tcctgtggct tcaagaaaag aagatacata tgttcatttt aatgtggaca ttgagctcca gaagcatgtt gaaaaattaa ccaaaggtgc agctatcttc tttgaattca aacactacaa gcctaaaaaa aggtttacca gcaccaagtg ttttgctttc atggagatgg atgaaattaa acctgggcca attgtaatag aactatacaa gaaacccact gactttaaaa gaaagaaatt gcaattattg accaagaaac cactttatct tcatctacat caaactttgc acaaggaatg a. It is sometimes possible for the material contained within the vial of "AIDA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
