Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AHNAK cdna clone

AHNAK cDNA Clone

Gene Names
AHNAK; AHNAKRS
Synonyms
AHNAK; AHNAK cDNA Clone; AHNAK cdna clone
Ordering
For Research Use Only!
Sequence
atggagaaggaggaggagacaacccgggagctgctgctgcccaactggcagggtagtggctcccacgggctgaccatcgcccagagggacgacggcgtctttgtgcaggaggtgacgcagaactcccctgcggcccgcactggggtggtcaaggagggggaccagattgtgggtgccaccatctactttgacaacctgcagtcgggtgaggtgacccagctgctgaacaccatggggcaccacacggtgggcctgaagctgcaccgcaagggggaccgctctcccgagcctggccagacctggacccgtgaagtcttcagctcctgcagctctgaagtggttctgaacacaccacagccatcagcactggaatgcaaagaccagaacaaacagaaggaagccagcagccaagccggggcagtttcagtctccaccccaaatgcaggactgtag
Sequence Length
453
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,061 Da
NCBI Official Full Name
Homo sapiens AHNAK nucleoprotein, mRNA
NCBI Official Synonym Full Names
AHNAK nucleoprotein
NCBI Official Symbol
AHNAK
NCBI Official Synonym Symbols
AHNAKRS
NCBI Protein Information
neuroblast differentiation-associated protein AHNAK
UniProt Protein Name
Neuroblast differentiation-associated protein AHNAK
UniProt Gene Name
AHNAK
UniProt Synonym Gene Names
PM227
UniProt Entry Name
AHNK_HUMAN

Uniprot Description

AHNAK: a giant propeller-like protein that associates with calcium channel proteins of cardiomyocytes and other cells. Translocates from the cytosol to the plasma membrane during the formation of cell-cell contacts and the development of epithelial polarity. At the plasma membrane, it associates as a multimeric complex with actin and the annexin 2/S100A10 complex. The AHNAK/annexin 2/S100A10 complex regulates cortical actin cytoskeleton organization and the architecture of the cell membrane.

Protein type: Actin-binding; Adaptor/scaffold; Cytoskeletal

Chromosomal Location of Human Ortholog: 11q12.2

Cellular Component: actin cytoskeleton; cell-cell adherens junction; costamere; cytoplasm; cytosol; focal adhesion; lipid raft; lysosomal membrane; membrane; nucleus; plasma membrane; sarcolemma; vesicle

Molecular Function: protein binding

Biological Process: protein oligomerization; regulation of RNA splicing

Research Articles on AHNAK

Similar Products

Product Notes

The AHNAK ahnak (Catalog #AAA1267144) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaagg aggaggagac aacccgggag ctgctgctgc ccaactggca gggtagtggc tcccacgggc tgaccatcgc ccagagggac gacggcgtct ttgtgcagga ggtgacgcag aactcccctg cggcccgcac tggggtggtc aaggaggggg accagattgt gggtgccacc atctactttg acaacctgca gtcgggtgag gtgacccagc tgctgaacac catggggcac cacacggtgg gcctgaagct gcaccgcaag ggggaccgct ctcccgagcc tggccagacc tggacccgtg aagtcttcag ctcctgcagc tctgaagtgg ttctgaacac accacagcca tcagcactgg aatgcaaaga ccagaacaaa cagaaggaag ccagcagcca agccggggca gtttcagtct ccaccccaaa tgcaggactg tag. It is sometimes possible for the material contained within the vial of "AHNAK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.