Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AGT cdna clone

AGT cDNA Clone

Gene Names
AGT; ANHU; SERPINA8
Synonyms
AGT; AGT cDNA Clone; AGT cdna clone
Ordering
For Research Use Only!
Sequence
atgcggaagcgagcaccccagtctgagatggctcctgccggtgtgagcctgagggccaccatcctctgcctcctggcctgggctggcctggctgcaggtgaccgggtgtacatacaccccttccacctcgtcatccacaatgagagtacctgtgagcagctggcaaaggccaatgccgggaagcccaaagaccccaccttcatacctgctccaattcaggccaagacatcccctgtggatgaaaaggccctacaggaccagctggtgctagtcgctgcaaaacttgacaccgaagacaagttgagggccgcaatggtcgggatgctggccaacttcttgggcttccgtatatatggcatgcacagtgagctatggggcgtggtccatggggccaccgtcctctccccaacggctgtctttggcaccctggcctctctctatctgggagccttggaccacacagctgacaggctacaggcaatcctgggtgttccttggaaggacaagaactgcacctcccggctggatgcgcacaaggtcctgtctgccctgcaggctgtacagggcctgctagtggcccagggcagggctgatagccaggcccagctgctgctgtccacggtggtgggcgtgttcacagccccaggcctgcacctgaagcagccgtttgtgcagggcctggctctctatacccctgtggtcctcccacgctctctggacttcacagaactggatgttgctgctgagaagattgacaggttcatgcaggctgtgacaggatggaagactggctgctccctgacgggagccagtgtggacagcaccctggctttcaacacctacgtccacttccaagggaagatgaagggcttctccctgctggccgagccccaggagttctgggtggacaacagcacctcagtgtctgttcccatgctctctggcatgggcaccttccagcactggagtgacatccaggacaacttctcggtgactcaagtgtccttcactgagagcgcctgcctgctgctgatccagcctcactatgcctctgacctggacaaggtggagggtctcactttccagcaaaactccctcaactggatgaagaaactgtctccccggaccatccacctgaccatgccccaactggtgctgcaaggatcttatgacctgcaggacctgctcgcccaggctgagctgcccgccattctgcacaccgagctgaacctgcaaaaattgagcaatgaccgcatcagggtgggggaggtgctgaacagcattttttttgagcttgaagcggatgagagagagcccacagagtctacccaacagcttaacaagcctgaggtcttggaggtgaccctgaaccgcccattcctgtttgctgtgtatgatcaaagcgccactgccctgcacttcctgggccgcgtggccaacccgctgagcacagcatga
Sequence Length
1458
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
183
Molecular Weight
53,154 Da
NCBI Official Full Name
Homo sapiens angiotensinogen (serpin peptidase inhibitor, clade A, member 8), mRNA
NCBI Official Synonym Full Names
angiotensinogen
NCBI Official Symbol
AGT
NCBI Official Synonym Symbols
ANHU; SERPINA8
NCBI Protein Information
angiotensinogen
UniProt Protein Name
Angiotensinogen
Protein Family
UniProt Gene Name
AGT
UniProt Synonym Gene Names
SERPINA8; Ang I; Ang II; Ang III; Ang IV
UniProt Entry Name
ANGT_HUMAN

NCBI Description

The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Jul 2008]

Uniprot Description

angiotensin: Essential component of the renin-angiotensin system (RAS), a potent regulator of blood pressure, body fluid and electrolyte homeostasis. In response to lowered blood pressure, the enzyme renin cleaves angiotensinogen to produce angiotensin-1 (angiotensin 1-10). Angiotensin-1 is a substrate of ACE (angiotensin converting enzyme) that removes a dipeptide to yield the physiologically active peptide angiotensin-2 (angiotensin 1- 8). Angiotensin-1 and angiotensin-2 can be further processed to generate angiotensin-3 (angiotensin 2-8), angiotensin-4 (angiotensin 3-8). Angiotensin 1-7 is cleaved from angiotensin-2 by ACE2 or from angiotensin-1 by MME (neprilysin). Angiotensin 1-9 is cleaved from angiotensin-1 by ACE2. Genetic variations in AGT are a cause of susceptibility to essential hypertension (EHT). Essential hypertension is a condition in which blood pressure is consistently higher than normal with no identifiable cause. Defects in AGT are a cause of renal tubular dysgenesis (RTD). RTD is an autosomal recessive severe disorder of renal tubular development characterized by persistent fetal anuria and perinatal death, probably due to pulmonary hypoplasia from early-onset oligohydramnios (the Potter phenotype). Belongs to the serpin family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 1q42.2

Cellular Component: extracellular region; extracellular space

Molecular Function: growth factor activity; hormone activity; protein binding; serine-type endopeptidase inhibitor activity; type 1 angiotensin receptor binding; type 2 angiotensin receptor binding

Biological Process: activation of NF-kappaB transcription factor; angiotensin maturation; blood vessel remodeling; cell-cell signaling; G-protein coupled receptor protein signaling pathway; G-protein signaling, coupled to cGMP nucleotide second messenger; kidney development; negative regulation of nerve growth factor receptor signaling pathway; nitric oxide mediated signal transduction; positive regulation of cellular protein metabolic process; positive regulation of cytokine production; positive regulation of epidermal growth factor receptor signaling pathway; positive regulation of fibroblast proliferation; positive regulation of inflammatory response; positive regulation of NAD(P)H oxidase activity; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of transcription, DNA-dependent; regulation of blood pressure; renal system process; renin-angiotensin regulation of blood vessel size; response to muscle activity involved in regulation of muscle adaptation

Disease: Hypertension, Essential; Renal Tubular Dysgenesis

Research Articles on AGT

Similar Products

Product Notes

The AGT agt (Catalog #AAA1270701) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggaagc gagcacccca gtctgagatg gctcctgccg gtgtgagcct gagggccacc atcctctgcc tcctggcctg ggctggcctg gctgcaggtg accgggtgta catacacccc ttccacctcg tcatccacaa tgagagtacc tgtgagcagc tggcaaaggc caatgccggg aagcccaaag accccacctt catacctgct ccaattcagg ccaagacatc ccctgtggat gaaaaggccc tacaggacca gctggtgcta gtcgctgcaa aacttgacac cgaagacaag ttgagggccg caatggtcgg gatgctggcc aacttcttgg gcttccgtat atatggcatg cacagtgagc tatggggcgt ggtccatggg gccaccgtcc tctccccaac ggctgtcttt ggcaccctgg cctctctcta tctgggagcc ttggaccaca cagctgacag gctacaggca atcctgggtg ttccttggaa ggacaagaac tgcacctccc ggctggatgc gcacaaggtc ctgtctgccc tgcaggctgt acagggcctg ctagtggccc agggcagggc tgatagccag gcccagctgc tgctgtccac ggtggtgggc gtgttcacag ccccaggcct gcacctgaag cagccgtttg tgcagggcct ggctctctat acccctgtgg tcctcccacg ctctctggac ttcacagaac tggatgttgc tgctgagaag attgacaggt tcatgcaggc tgtgacagga tggaagactg gctgctccct gacgggagcc agtgtggaca gcaccctggc tttcaacacc tacgtccact tccaagggaa gatgaagggc ttctccctgc tggccgagcc ccaggagttc tgggtggaca acagcacctc agtgtctgtt cccatgctct ctggcatggg caccttccag cactggagtg acatccagga caacttctcg gtgactcaag tgtccttcac tgagagcgcc tgcctgctgc tgatccagcc tcactatgcc tctgacctgg acaaggtgga gggtctcact ttccagcaaa actccctcaa ctggatgaag aaactgtctc cccggaccat ccacctgacc atgccccaac tggtgctgca aggatcttat gacctgcagg acctgctcgc ccaggctgag ctgcccgcca ttctgcacac cgagctgaac ctgcaaaaat tgagcaatga ccgcatcagg gtgggggagg tgctgaacag catttttttt gagcttgaag cggatgagag agagcccaca gagtctaccc aacagcttaa caagcctgag gtcttggagg tgaccctgaa ccgcccattc ctgtttgctg tgtatgatca aagcgccact gccctgcact tcctgggccg cgtggccaac ccgctgagca cagcatga. It is sometimes possible for the material contained within the vial of "AGT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.