Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AGPAT5 cdna clone

AGPAT5 cDNA Clone

Gene Names
AGPAT5; LPAATE; 1AGPAT5
Synonyms
AGPAT5; AGPAT5 cDNA Clone; AGPAT5 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgtccctggtgctccacacgtactccatgcgctacctgctgcccagcgtcgtgctcctgggcacggcgcccacctacgtgttggcctggggggtctggcggctgctctccgccttcctgcccgcccgcttctaccaagcgctggacgaccggctctactgcgtctaccagagcatggtgctcttcttcttcgagaattacaccggggtccagatattgctatatggagatttgccaaaaaataaagaaaatataatatatttagcaaatcatcaaagcacagttgactggattgttgctgacatcttggccatcaggcagaatgcgctaggacatgtgcgctacgtgctgaaagaagggttaaaatggctgccattgtatgggtgttactttgctcagcatggaggaatctatgtaaagcgcagtgccaaatttaacgagaaagagatgcgaaacaagttgcagagctacgtggacgcaggaactccaatgtatcttgtgatttttccagaaggtacaaggtataatccagagcaaacaaaagtcctttcagctagtcaggcatttgctgcccaacgtggccttgcagtattaaaacatgtgctaacaccacgaataaaggcaactcacgttgcttttgattgcatgaagaattatttagatgcaatttatgatgttacggtggtttatgaagggaaagacgatggagggcagcgaagagagtcaccgaccatgacggaatttctctgcaaagaatgtccaaaaattcatattcacattgatcgtatcgacaaaaaagatgtcccagaagaacaagaacatatgagaagatggctgcatgaacgtttcgaaatcaaagataagatgcttatagaattttatgagtcaccagatccagaaagaagaaaaagatttcctgggaaaagtgttaattccaaattaagtatcaagaagactttaccatcaatgttgatcttaagtggtttgactgcaggcatgcttatgaccgatgctggaaggaagctgtatgtgaacacctggatatatggaaccctacttggctgcctgtgggttactattaaagcatag
Sequence Length
1095
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,072 Da
NCBI Official Full Name
Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon), mRNA
NCBI Official Synonym Full Names
1-acylglycerol-3-phosphate O-acyltransferase 5
NCBI Official Symbol
AGPAT5
NCBI Official Synonym Symbols
LPAATE; 1AGPAT5
NCBI Protein Information
1-acyl-sn-glycerol-3-phosphate acyltransferase epsilon
UniProt Protein Name
1-acyl-sn-glycerol-3-phosphate acyltransferase epsilon
UniProt Gene Name
AGPAT5
UniProt Synonym Gene Names
1-AGP acyltransferase 5; 1-AGPAT 5; LPAAT-epsilon
UniProt Entry Name
PLCE_HUMAN

NCBI Description

This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. This integral membrane protein converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. A pseudogene of this gene is present on the Y chromosome. [provided by RefSeq, Aug 2014]

Uniprot Description

AGPAT5: Converts lysophosphatidic acid (LPA) into phosphatidic acid by incorporating an acyl moiety at the sn-2 position of the glycerol backbone. Belongs to the 1-acyl-sn-glycerol-3-phosphate acyltransferase family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Transferase; EC 2.3.1.51

Chromosomal Location of Human Ortholog: 8p23.1

Cellular Component: endoplasmic reticulum membrane; mitochondrial outer membrane; mitochondrion

Molecular Function: 1-acylglycerol-3-phosphate O-acyltransferase activity; protein binding

Biological Process: phosphatidic acid biosynthetic process; triacylglycerol biosynthetic process

Research Articles on AGPAT5

Similar Products

Product Notes

The AGPAT5 agpat5 (Catalog #AAA1275718) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgt ccctggtgct ccacacgtac tccatgcgct acctgctgcc cagcgtcgtg ctcctgggca cggcgcccac ctacgtgttg gcctgggggg tctggcggct gctctccgcc ttcctgcccg cccgcttcta ccaagcgctg gacgaccggc tctactgcgt ctaccagagc atggtgctct tcttcttcga gaattacacc ggggtccaga tattgctata tggagatttg ccaaaaaata aagaaaatat aatatattta gcaaatcatc aaagcacagt tgactggatt gttgctgaca tcttggccat caggcagaat gcgctaggac atgtgcgcta cgtgctgaaa gaagggttaa aatggctgcc attgtatggg tgttactttg ctcagcatgg aggaatctat gtaaagcgca gtgccaaatt taacgagaaa gagatgcgaa acaagttgca gagctacgtg gacgcaggaa ctccaatgta tcttgtgatt tttccagaag gtacaaggta taatccagag caaacaaaag tcctttcagc tagtcaggca tttgctgccc aacgtggcct tgcagtatta aaacatgtgc taacaccacg aataaaggca actcacgttg cttttgattg catgaagaat tatttagatg caatttatga tgttacggtg gtttatgaag ggaaagacga tggagggcag cgaagagagt caccgaccat gacggaattt ctctgcaaag aatgtccaaa aattcatatt cacattgatc gtatcgacaa aaaagatgtc ccagaagaac aagaacatat gagaagatgg ctgcatgaac gtttcgaaat caaagataag atgcttatag aattttatga gtcaccagat ccagaaagaa gaaaaagatt tcctgggaaa agtgttaatt ccaaattaag tatcaagaag actttaccat caatgttgat cttaagtggt ttgactgcag gcatgcttat gaccgatgct ggaaggaagc tgtatgtgaa cacctggata tatggaaccc tacttggctg cctgtgggtt actattaaag catag. It is sometimes possible for the material contained within the vial of "AGPAT5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.