Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AGGF1 cdna clone

AGGF1 cDNA Clone

Gene Names
AGGF1; VG5Q; GPATC7; GPATCH7; HSU84971; HUS84971
Synonyms
AGGF1; AGGF1 cDNA Clone; AGGF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcggaggcgccgtccccgccgcggtcgccgccgccgcccacctcccccgagcctgagctggcccagctaaggcggaaggtggagaagttggaacgtgaactgcggagctgcaagcggcaggtgcgggagatcgagaagctgctgcatcacacagaacggctgtaccagaacgcagaaagcaacaaccaggagctccgcacgcaggtggaagaactcagtaaaatactccaacgtgggagaaatgaagataataaaaagtctgatgtagaagtacaaacagagaaccatgctccttggtcaatctcagattatttttatcagacgtactacaatgacgttagtcttccaaataaagtgactgaactgtcagatcaacaagatcaagctatcgaaacttctattttgaattctaaagaccatttacaagtagaaaatgatgcttaccctggtaccgatagaacagaaaatgttaaatatagacaagtggaccattttgcctcaaattcacaggagccagcatctgcattagcaacagaagatacctccttagaaggctcatcattagctgaaagtttgagagctgcagcagaagcggctgtatcacagactggatttagttatgatgaaaatactggactgtattttgaccacagcactggtttctattatgattctgaaaatcaactctattatgatccttccactggaatttattactattgtgatgtggaaagtggtcgttatcagtttcattctcgagtagatttgcaaccttatccgacttctagcacaaaacaaagtaaagataaaaaattgaagaagaaaagaaaagatccagattcttctgcaacaaatgaggaaaaggatttgaactcagaggatcaaaaagccttcagtgttgaacatacaagctgcaatgaggaagaaaatttcgcaaatatgaaaaagaaggccaaaataggcattcatcacaaaaatagtccccccaaagtcactgttccaactagtggaaatactatagagtctcctcttcatgaaaacatctctaattcaacatcatttaaagatgagaaaatcatggagactgatagtgaaccagaggaaggtgaaattacagactctcagactgaggatagttatgacgaagccattaccagtgaaggcaatgtaactgcagaagatagtgaggatgaagatgaagacaaaatttggcccccatgtattagagtaattgtcattagatcacctgtgttgcagataggatcactctttatcattactgctgtaaaccctgctacaattggaagagaaaaggatatggaacatactctccgaatccctgaagttggtgtcagtaagtttcatgcagaaatttattttgaccatgacttacaaagttatgtccttgtggatcaaggcagtcaaaatggcacaattgttaatggaaaacagattcttcagccgaaaactaaatgtgacccttacgtacttgagcatggagatgaagtcaaaattggagaaactgtcttatcctttcacattcatcctggcagtgatacctgtgatggctgtgaacgagggcaggttagagcccaccttcgccttgataagaaagatgaatcttttgttggtccaacactaagtaaggaggaaaaagagttggaaggaagaaaagaattaaagaaaatacgagtaaaatatggtttacagaatacagaatacgaagatgaaaagacattgaagaatccaaaatataaagatagagctggaaaacgtagggagcaggttggaagtgaaggaactttccaaagagatgatgctcctgcatctgttcattctgaaattactgatagcaacaaaggtcggaagttgttggagaagatgggttggaagaaaggagagggcctggggaaggatggtggaggaatgaaaacgccgatccagcttcagcttcggcgaacacatgcaggcttggggacaggcaaaccatcctcatttgaagatgttcaccttctccaaaacaagaacaaaaaaaactgggacaaagcacgagagcggtttactgaaaacttcccagaaactaagcctcaaaaagatgacccagggaccatgccttgggtaaaagggactttagagtga
Sequence Length
2145
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,506 Da
NCBI Official Full Name
Homo sapiens angiogenic factor with G patch and FHA domains 1, mRNA
NCBI Official Synonym Full Names
angiogenic factor with G-patch and FHA domains 1
NCBI Official Symbol
AGGF1
NCBI Official Synonym Symbols
VG5Q; GPATC7; GPATCH7; HSU84971; HUS84971
NCBI Protein Information
angiogenic factor with G patch and FHA domains 1
UniProt Protein Name
Angiogenic factor with G patch and FHA domains 1
UniProt Gene Name
AGGF1
UniProt Synonym Gene Names
GPATC7; GPATCH7; VG5Q; hVG5Q
UniProt Entry Name
AGGF1_HUMAN

NCBI Description

This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]

Uniprot Description

AGGF1: Promotes angiogenesis and the proliferation of endothelial cells. Able to bind to endothelial cells and promote cell proliferation, suggesting that it may act in an autocrine fashion. Defects in AGGF1 are a cause of Klippel-Trenaunay syndrome (KTS). KTS is a congenital disease characterized by malformations of capillary (98% of KTS patients), venous (72%) and lymphatic (11%) vessels, and bony and soft tissue hypertrophy that leads to large cutaneous hemangiomata with hypertrophy of the related bones and soft tissues. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA processing; Cell adhesion

Chromosomal Location of Human Ortholog: 5q13.3

Cellular Component: cytoplasm; extracellular region; nuclear speck; perinuclear region of cytoplasm

Molecular Function: protein binding; RNA binding

Biological Process: cell adhesion; mRNA processing; positive regulation of angiogenesis; positive regulation of endothelial cell proliferation; regulation of RNA splicing; RNA processing; vasculogenesis

Disease: Klippel-trenaunay-weber Syndrome

Research Articles on AGGF1

Similar Products

Product Notes

The AGGF1 aggf1 (Catalog #AAA1278615) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcgg aggcgccgtc cccgccgcgg tcgccgccgc cgcccacctc ccccgagcct gagctggccc agctaaggcg gaaggtggag aagttggaac gtgaactgcg gagctgcaag cggcaggtgc gggagatcga gaagctgctg catcacacag aacggctgta ccagaacgca gaaagcaaca accaggagct ccgcacgcag gtggaagaac tcagtaaaat actccaacgt gggagaaatg aagataataa aaagtctgat gtagaagtac aaacagagaa ccatgctcct tggtcaatct cagattattt ttatcagacg tactacaatg acgttagtct tccaaataaa gtgactgaac tgtcagatca acaagatcaa gctatcgaaa cttctatttt gaattctaaa gaccatttac aagtagaaaa tgatgcttac cctggtaccg atagaacaga aaatgttaaa tatagacaag tggaccattt tgcctcaaat tcacaggagc cagcatctgc attagcaaca gaagatacct ccttagaagg ctcatcatta gctgaaagtt tgagagctgc agcagaagcg gctgtatcac agactggatt tagttatgat gaaaatactg gactgtattt tgaccacagc actggtttct attatgattc tgaaaatcaa ctctattatg atccttccac tggaatttat tactattgtg atgtggaaag tggtcgttat cagtttcatt ctcgagtaga tttgcaacct tatccgactt ctagcacaaa acaaagtaaa gataaaaaat tgaagaagaa aagaaaagat ccagattctt ctgcaacaaa tgaggaaaag gatttgaact cagaggatca aaaagccttc agtgttgaac atacaagctg caatgaggaa gaaaatttcg caaatatgaa aaagaaggcc aaaataggca ttcatcacaa aaatagtccc cccaaagtca ctgttccaac tagtggaaat actatagagt ctcctcttca tgaaaacatc tctaattcaa catcatttaa agatgagaaa atcatggaga ctgatagtga accagaggaa ggtgaaatta cagactctca gactgaggat agttatgacg aagccattac cagtgaaggc aatgtaactg cagaagatag tgaggatgaa gatgaagaca aaatttggcc cccatgtatt agagtaattg tcattagatc acctgtgttg cagataggat cactctttat cattactgct gtaaaccctg ctacaattgg aagagaaaag gatatggaac atactctccg aatccctgaa gttggtgtca gtaagtttca tgcagaaatt tattttgacc atgacttaca aagttatgtc cttgtggatc aaggcagtca aaatggcaca attgttaatg gaaaacagat tcttcagccg aaaactaaat gtgaccctta cgtacttgag catggagatg aagtcaaaat tggagaaact gtcttatcct ttcacattca tcctggcagt gatacctgtg atggctgtga acgagggcag gttagagccc accttcgcct tgataagaaa gatgaatctt ttgttggtcc aacactaagt aaggaggaaa aagagttgga aggaagaaaa gaattaaaga aaatacgagt aaaatatggt ttacagaata cagaatacga agatgaaaag acattgaaga atccaaaata taaagataga gctggaaaac gtagggagca ggttggaagt gaaggaactt tccaaagaga tgatgctcct gcatctgttc attctgaaat tactgatagc aacaaaggtc ggaagttgtt ggagaagatg ggttggaaga aaggagaggg cctggggaag gatggtggag gaatgaaaac gccgatccag cttcagcttc ggcgaacaca tgcaggcttg gggacaggca aaccatcctc atttgaagat gttcaccttc tccaaaacaa gaacaaaaaa aactgggaca aagcacgaga gcggtttact gaaaacttcc cagaaactaa gcctcaaaaa gatgacccag ggaccatgcc ttgggtaaaa gggactttag agtga. It is sometimes possible for the material contained within the vial of "AGGF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.