Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AGFG2 cdna clone

AGFG2 cDNA Clone

Gene Names
AGFG2; HRBL; RABR
Synonyms
AGFG2; AGFG2 cDNA Clone; AGFG2 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgatggcggcgaagaagggcccgggcccgggcggcggggtcagcgggggcaaggcggaggcggaggcggcctcggaggtgtggtgccgtcgggtgcgggagctgggtggctgcagccaggccgggaaccgccactgcttcgagtgcgcccagcgcggggtcacctacgtggatatcaccgtgggcagcttcgtgtgcaccacctgctccggcctcctgagagggctgaacccccctcatcgtgtcaagtcaatctccatgacaactttcactgagcctgaagtagtattcctgcaatcccgtggaaatgaggtttgccggaagatttggttgggtctgtttgatgctcggacatctttagtaccagattccagggatcctcagaaagtgaaggagtttctccaggaaaaatatgagaagaagagatggccagacaccttcccaaggaggctttgccaactttga
Sequence Length
468
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,344 Da
NCBI Official Full Name
Homo sapiens ArfGAP with FG repeats 2, mRNA
NCBI Official Synonym Full Names
ArfGAP with FG repeats 2
NCBI Official Symbol
AGFG2
NCBI Official Synonym Symbols
HRBL; RABR
NCBI Protein Information
arf-GAP domain and FG repeat-containing protein 2
UniProt Protein Name
Arf-GAP domain and FG repeat-containing protein 2
UniProt Gene Name
AGFG2
UniProt Synonym Gene Names
HRBL; RABR; RAB-R
UniProt Entry Name
AGFG2_HUMAN

NCBI Description

This gene is a member of the HIV-1 Rev binding protein (HRB) family and encodes a protein with one Arf-GAP zinc finger domain, several phe-gly (FG) motifs, and four asn-pro-phe (NPF) motifs. This protein interacts with Eps15 homology (EH) domains and plays a role in the Rev export pathway, which mediates the nucleocytoplasmic transfer of proteins and RNAs. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Feb 2013]

Uniprot Description

HRBL: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: membrane

Similar Products

Product Notes

The AGFG2 agfg2 (Catalog #AAA1273922) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgatgg cggcgaagaa gggcccgggc ccgggcggcg gggtcagcgg gggcaaggcg gaggcggagg cggcctcgga ggtgtggtgc cgtcgggtgc gggagctggg tggctgcagc caggccggga accgccactg cttcgagtgc gcccagcgcg gggtcaccta cgtggatatc accgtgggca gcttcgtgtg caccacctgc tccggcctcc tgagagggct gaacccccct catcgtgtca agtcaatctc catgacaact ttcactgagc ctgaagtagt attcctgcaa tcccgtggaa atgaggtttg ccggaagatt tggttgggtc tgtttgatgc tcggacatct ttagtaccag attccaggga tcctcagaaa gtgaaggagt ttctccagga aaaatatgag aagaagagat ggccagacac cttcccaagg aggctttgcc aactttga. It is sometimes possible for the material contained within the vial of "AGFG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.