Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADORA2A cdna clone

ADORA2A cDNA Clone

Gene Names
ADORA2A; A2aR; RDC8; ADORA2
Synonyms
ADORA2A; ADORA2A cDNA Clone; ADORA2A cdna clone
Ordering
For Research Use Only!
Sequence
atgcccatcatgggctcctcggtgtacatcacggtggagctggccattgctgtgctggccatcctgggcaatgtgctggtgtgctgggccgtgtggctcaacagcaacctgcagaacgtcaccaactactttgtggtgtcactggcggcggccgacatcgcagtgggtgtgctcgccatcccctttgccatcaccatcagcaccgggttctgcgctgcctgccacggctgcctcttcattgcctgcttcgtcctggtcctcacgcagagctccatcttcagtctcctggccatcgccattgaccgctacattgccatccgcatcccgctccggtacaatggcttggtgaccggcacgagggctaagggcatcattgccatctgctgggtgctgtcgtttgccatcggcctgactcccatgctaggttggaacaactgcggtcagccaaaggagggcaagaaccactcccagggctgcggggagggccaagtggcctgtctctttgaggatgtggtccccatgaactacatggtgtacttcaacttctttgcctgtgtgctggtgcccctgctgctcatgctgggtgtctatttgcggatcttcctggcggcgcgacgacagctgaagcagatggagagccagcctctgccgggggagcgggcacggtccacactgcagaaggaggtccatgctgccaagtcactggccatcattgtggggctctttgccctctgctggctgcccctacacatcatcaactgcttcactttcttctgccccgactgcagccacgcccctctctggctcatgtacctggccatcgtcctctcccacaccaattcggttgtgaatcccttcatctacgcctaccgtatccgcgagttccgccagaccttccgcaagatcattcgcagccacgtcctgaggcagcaagaacctttcaaggcagctggcaccagtgcccgggtcttggcagctcatggcagtgacggagagcaggtcagcctccgtctcaacggccacccgccaggagtgtgggccaacggcagtgctccccaccctgagcggaggcccaatggctacgccctggggctggtgagtggagggagtgcccaagagtcccaggggaacacgggcctcccagacgtggagctccttagccatgagctcaagggagtgtgcccagagccccctggcctagatgaccccctggcccaggatggagcaggagtgtcctga
Sequence Length
1239
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
135
Molecular Weight
44,707 Da
NCBI Official Full Name
Homo sapiens adenosine A2a receptor, mRNA
NCBI Official Synonym Full Names
adenosine A2a receptor
NCBI Official Symbol
ADORA2A
NCBI Official Synonym Symbols
A2aR; RDC8; ADORA2
NCBI Protein Information
adenosine receptor A2a
UniProt Protein Name
Adenosine receptor A2a
Protein Family
UniProt Gene Name
ADORA2A
UniProt Synonym Gene Names
ADORA2
UniProt Entry Name
AA2AR_HUMAN

NCBI Description

This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]

Uniprot Description

ADORA2A: one of several receptor subtypes for adenosine. A G-protein coupled receptor. Activation is mediated by G proteins which activate adenylyl cyclase. Abundant in basal ganglia, vasculature and platelets and it is a major target of caffeine.

Protein type: GPCR, family 1; Membrane protein, integral; Receptor, GPCR; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 22q11.23

Cellular Component: integral to plasma membrane; membrane; plasma membrane

Molecular Function: adenosine receptor activity, G-protein coupled; enzyme binding; identical protein binding; protein binding

Biological Process: apoptosis; blood circulation; blood coagulation; cAMP biosynthetic process; cell-cell signaling; cellular defense response; cellular protein metabolic process; central nervous system development; G-protein signaling, coupled to cAMP nucleotide second messenger; inflammatory response; phagocytosis; sensory perception

Research Articles on ADORA2A

Similar Products

Product Notes

The ADORA2A adora2a (Catalog #AAA1274368) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccatca tgggctcctc ggtgtacatc acggtggagc tggccattgc tgtgctggcc atcctgggca atgtgctggt gtgctgggcc gtgtggctca acagcaacct gcagaacgtc accaactact ttgtggtgtc actggcggcg gccgacatcg cagtgggtgt gctcgccatc ccctttgcca tcaccatcag caccgggttc tgcgctgcct gccacggctg cctcttcatt gcctgcttcg tcctggtcct cacgcagagc tccatcttca gtctcctggc catcgccatt gaccgctaca ttgccatccg catcccgctc cggtacaatg gcttggtgac cggcacgagg gctaagggca tcattgccat ctgctgggtg ctgtcgtttg ccatcggcct gactcccatg ctaggttgga acaactgcgg tcagccaaag gagggcaaga accactccca gggctgcggg gagggccaag tggcctgtct ctttgaggat gtggtcccca tgaactacat ggtgtacttc aacttctttg cctgtgtgct ggtgcccctg ctgctcatgc tgggtgtcta tttgcggatc ttcctggcgg cgcgacgaca gctgaagcag atggagagcc agcctctgcc gggggagcgg gcacggtcca cactgcagaa ggaggtccat gctgccaagt cactggccat cattgtgggg ctctttgccc tctgctggct gcccctacac atcatcaact gcttcacttt cttctgcccc gactgcagcc acgcccctct ctggctcatg tacctggcca tcgtcctctc ccacaccaat tcggttgtga atcccttcat ctacgcctac cgtatccgcg agttccgcca gaccttccgc aagatcattc gcagccacgt cctgaggcag caagaacctt tcaaggcagc tggcaccagt gcccgggtct tggcagctca tggcagtgac ggagagcagg tcagcctccg tctcaacggc cacccgccag gagtgtgggc caacggcagt gctccccacc ctgagcggag gcccaatggc tacgccctgg ggctggtgag tggagggagt gcccaagagt cccaggggaa cacgggcctc ccagacgtgg agctccttag ccatgagctc aagggagtgt gcccagagcc ccctggccta gatgaccccc tggcccagga tggagcagga gtgtcctga. It is sometimes possible for the material contained within the vial of "ADORA2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.