Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADK cdna clone

ADK cDNA Clone

Gene Names
ADK; AK
Synonyms
ADK; ADK cDNA Clone; ADK cdna clone
Ordering
For Research Use Only!
Sequence
atgacgtcagtcagagaaaatattctctttggaatgggaaatcctctgcttgacatctctgctgtagtggacaaagatttccttgataagtattctctgaaaccaaatgaccaaatcttggctgaagacaaacacaaggaactgtttgatgaacttgtgaaaaaattcaaagtcgaatatcatgctggtggctctacccagaattcaattaaagtggctcagtggatgattcaacagccacacaaagcagcaacattttttggatgcattgggatagataaatttggggagatcctgaagagaaaagctgctgaagcccatgtggatgctcattactacgagcagaatgagcagccaacaggaacttgtgctgcatgcatcactggtgacaacaggtccctcatagctaatcttgctgctgccaattgttataaaaaggaaaaacatcttgatctggagaaaaactggatgttggtagaaaaagcaagagtttgttatatagcaggcttttttcttacagtttccccagagtcagtattaaaggtggctcaccatgcttctgaaaacaacaggattttcactttgaatctatctgcaccgttttttagccagttctacaaggaatcattgatgaaagttatgccttatgttgatatactttttggaaatgagacagaagctgccacttttgctagagagcaaggctttgagactaaagacattaaagagatagccaaaaagacacaagccctgccaaagatgaactcaaagaggcagcgaatcgtgatcttcacccaagggagagatgacactataatggctacagaaagtgaagtcactgcttttgctgtcttggatcaagaccagaaagaaattattgataccaatggagctggagatgcatttgttggaggttttctgtctcaactggtctctgacaagcctctgactgaatgtatccgtgctggccactatgcagcaagcatcataattagacggactggctgcacctttcctgagaagccagacttccactga
Sequence Length
1038
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
132
Molecular Weight
36,580 Da
NCBI Official Full Name
Homo sapiens adenosine kinase, mRNA
NCBI Official Synonym Full Names
adenosine kinase
NCBI Official Symbol
ADK
NCBI Official Synonym Symbols
AK
NCBI Protein Information
adenosine kinase
UniProt Protein Name
Adenosine kinase
UniProt Gene Name
ADK
UniProt Synonym Gene Names
AK
UniProt Entry Name
ADK_HUMAN

NCBI Description

This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

ADK: ATP dependent phosphorylation of adenosine and other related nucleoside analogs to monophosphate derivatives. Serves as a potential regulator of concentrations of extracellular adenosine and intracellular adenine nucleotides. Defects in ADK are the cause of hypermethioninemia due to adenosine kinase deficiency (HMAKD). A metabolic disorder characterized by global developmental delay, early-onset seizures, mild dysmorphic features, and characteristic biochemical anomalies, including persistent hypermethioninemia with increased levels of S-adenosylmethionine and S-adenosylhomocysteine. Homocysteine levels are typically normal. Belongs to the carbohydrate kinase PfkB family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation; Kinase, other; Nucleotide Metabolism - purine; EC 2.7.1.20

Chromosomal Location of Human Ortholog: 10q22|10q11-q24

Cellular Component: cytoplasm; cytosol; nucleoplasm

Molecular Function: adenosine kinase activity

Biological Process: purine salvage; ribonucleoside monophosphate biosynthetic process

Disease: Hypermethioninemia Due To Adenosine Kinase Deficiency

Research Articles on ADK

Similar Products

Product Notes

The ADK adk (Catalog #AAA1271832) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgtcag tcagagaaaa tattctcttt ggaatgggaa atcctctgct tgacatctct gctgtagtgg acaaagattt ccttgataag tattctctga aaccaaatga ccaaatcttg gctgaagaca aacacaagga actgtttgat gaacttgtga aaaaattcaa agtcgaatat catgctggtg gctctaccca gaattcaatt aaagtggctc agtggatgat tcaacagcca cacaaagcag caacattttt tggatgcatt gggatagata aatttgggga gatcctgaag agaaaagctg ctgaagccca tgtggatgct cattactacg agcagaatga gcagccaaca ggaacttgtg ctgcatgcat cactggtgac aacaggtccc tcatagctaa tcttgctgct gccaattgtt ataaaaagga aaaacatctt gatctggaga aaaactggat gttggtagaa aaagcaagag tttgttatat agcaggcttt tttcttacag tttccccaga gtcagtatta aaggtggctc accatgcttc tgaaaacaac aggattttca ctttgaatct atctgcaccg ttttttagcc agttctacaa ggaatcattg atgaaagtta tgccttatgt tgatatactt tttggaaatg agacagaagc tgccactttt gctagagagc aaggctttga gactaaagac attaaagaga tagccaaaaa gacacaagcc ctgccaaaga tgaactcaaa gaggcagcga atcgtgatct tcacccaagg gagagatgac actataatgg ctacagaaag tgaagtcact gcttttgctg tcttggatca agaccagaaa gaaattattg ataccaatgg agctggagat gcatttgttg gaggttttct gtctcaactg gtctctgaca agcctctgac tgaatgtatc cgtgctggcc actatgcagc aagcatcata attagacgga ctggctgcac ctttcctgag aagccagact tccactga. It is sometimes possible for the material contained within the vial of "ADK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.