Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADIPOR2 cdna clone

ADIPOR2 cDNA Clone

Gene Names
ADIPOR2; PAQR2; ACDCR2
Synonyms
ADIPOR2; ADIPOR2 cDNA Clone; ADIPOR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacgagccaacagaaaaccgattggggtgcagcaggactccagagccagatataaggctcagaaaagggcaccaactggatggtacacgaagaggtgataatgacagccaccaaggagatttggagcccattttagaggcatctgttctatcttcccatcataaaaaaagctctgaggaacatgaatacagtgatgaagctcctcaggaagatgagggctttatgggcatgtcccctctcttacaagcccatcatgctatggaaaaaatggaagaatttgtttgtaaggtatgggaaggtcggtggcgagtgatccctcatgatgtactaccagactggctcaaggataatgacttcctcttgcatggacaccggcctcctatgccttctttccgggcctgttttaagagcattttcagaatacacacagaaacaggcaacatttggacacatctcttaggttgtgtattcttcctgtgcctggggatcttttatatgtttcgcccaaatatctcctttgtggcccctctgcaagagaaggtggtctttggattatttttcttaggagccattctctgcctttctttttcatggctcttccacacagtctactgccactcagagggggtctctcggctcttctctaaactggattactctggtattgctcttctgattatgggaagttttgttccttggctttattattctttctactgtaatccacaaccttgcttcatctacttgattgtcatctgtgtgctgggcattgcagccattatagtctcccagtgggacatgtttgccacccctcagtatcggggagtaagagcaggagtgtttttgggcctaggcctgagtggaatcattcctaccttgcactatgtcatctcggaggggttccttaaggccgccaccatagggcagataggctggttgatgctgatggccagcctctacatcacaggagctgccctgtatgctgcccggatccccgaacgctttttccctggcaaatgtgacatctggtttcactctcatcagctgtttcatatctttgtggttgctggagcttttgttcacttccatggtgtctcaaacctccaggagtttcgtttcatgatcggcgggggctgcagtgaagaggatgcactgtga
Sequence Length
1161
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,884 Da
NCBI Official Full Name
Homo sapiens adiponectin receptor 2, mRNA
NCBI Official Synonym Full Names
adiponectin receptor 2
NCBI Official Symbol
ADIPOR2
NCBI Official Synonym Symbols
PAQR2; ACDCR2
NCBI Protein Information
adiponectin receptor protein 2
UniProt Protein Name
Adiponectin receptor protein 2
UniProt Gene Name
ADIPOR2
UniProt Entry Name
ADR2_HUMAN

NCBI Description

The adiponectin receptors, ADIPOR1 (MIM 607945) and ADIPOR2, serve as receptors for globular and full-length adiponectin (MIM 605441) and mediate increased AMPK (see MIM 602739) and PPAR-alpha (PPARA; MIM 170998) ligand activities, as well as fatty acid oxidation and glucose uptake by adiponectin (Yamauchi et al., 2003 [PubMed 12802337]).[supplied by OMIM, Mar 2008]

Uniprot Description

ADIPOR2: Receptor for globular and full-length adiponectin (APM1), an essential hormone secreted by adipocytes that acts as an antidiabetic. Probably involved in metabolic pathways that regulate lipid metabolism such as fatty acid oxidation. Mediates increased AMPK, PPARA ligand activity, fatty acid oxidation and glucose uptake by adiponectin. Has some intermediate-affinity receptor activity for both globular and full-length adiponectin. Belongs to the ADIPOR family.

Protein type: Membrane protein, integral; Receptor, misc.; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 12p13.31

Cellular Component: intrinsic to plasma membrane

Molecular Function: adiponectin binding

Biological Process: adiponectin-mediated signaling pathway; fatty acid oxidation; glucose homeostasis; hormone-mediated signaling

Research Articles on ADIPOR2

Similar Products

Product Notes

The ADIPOR2 adipor2 (Catalog #AAA1269325) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacgagc caacagaaaa ccgattgggg tgcagcagga ctccagagcc agatataagg ctcagaaaag ggcaccaact ggatggtaca cgaagaggtg ataatgacag ccaccaagga gatttggagc ccattttaga ggcatctgtt ctatcttccc atcataaaaa aagctctgag gaacatgaat acagtgatga agctcctcag gaagatgagg gctttatggg catgtcccct ctcttacaag cccatcatgc tatggaaaaa atggaagaat ttgtttgtaa ggtatgggaa ggtcggtggc gagtgatccc tcatgatgta ctaccagact ggctcaagga taatgacttc ctcttgcatg gacaccggcc tcctatgcct tctttccggg cctgttttaa gagcattttc agaatacaca cagaaacagg caacatttgg acacatctct taggttgtgt attcttcctg tgcctgggga tcttttatat gtttcgccca aatatctcct ttgtggcccc tctgcaagag aaggtggtct ttggattatt tttcttagga gccattctct gcctttcttt ttcatggctc ttccacacag tctactgcca ctcagagggg gtctctcggc tcttctctaa actggattac tctggtattg ctcttctgat tatgggaagt tttgttcctt ggctttatta ttctttctac tgtaatccac aaccttgctt catctacttg attgtcatct gtgtgctggg cattgcagcc attatagtct cccagtggga catgtttgcc acccctcagt atcggggagt aagagcagga gtgtttttgg gcctaggcct gagtggaatc attcctacct tgcactatgt catctcggag gggttcctta aggccgccac catagggcag ataggctggt tgatgctgat ggccagcctc tacatcacag gagctgccct gtatgctgcc cggatccccg aacgcttttt ccctggcaaa tgtgacatct ggtttcactc tcatcagctg tttcatatct ttgtggttgc tggagctttt gttcacttcc atggtgtctc aaacctccag gagtttcgtt tcatgatcgg cgggggctgc agtgaagagg atgcactgtg a. It is sometimes possible for the material contained within the vial of "ADIPOR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.