Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ADH5 cdna clone

ADH5 cDNA Clone

Gene Names
ADH5; FDH; ADHX; ADH-3; FALDH; GSNOR; GSH-FDH; HEL-S-60p
Synonyms
ADH5; ADH5 cDNA Clone; ADH5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaacgaggttatcaagtgcaaggctgcagttgcttgggaggctggaaagcctctctccatagaggagatagaggtggcacccccaaaggctcatgaagttcgaatcaagatcattgccactgcggtttgccacaccgatgcctataccctgagtggagctgatcctgagggttgttttccagtgatcttgggacatgaaggtgctggaattgtggaaagtgttggtgagggagttactaagctgaaggcgggtgacactgtcatcccactttacatcccacagtgtggagaatgcaaattttgtctaaatcctaaaactaacctttgccagaagataagagtcactcaagggaaaggattaatgccagatggtaccagcagatttacttgcaaaggaaagacaattttgcattacatgggaaccagcacattttctgaatacacagttgtggctgatatctctgttgctaaaatagatcctttagcacctttggataaagtctgccttctaggttgtggcatttcaaccggttatggtgctgctgtgaacactgccaagttggagcctggctctgtttgtgccgtctttggtctgggaggagtcggattggcagttatcatgggctgtaaagtggctggtgcttcccggatcattggtgtggacatcaataaagataaatttgcaagggccaaagagtttggagccactgaatgtattaaccctcaggattttagtaaacccatccaggaagtgctcattgagatgaccgatggaggagtggactattcctttgaatgtattggtaatgtgaaggtcatgagagcagcacttgaggcatgtcacaagggctggggcgtcagcgtcgtggttggagtagctgcttcaggtgaagaaattgccactcgtccattccagctggtaacaggtcgcacatggaaaggcactgcctttggaggatggaagagtgtagaaagtgtcccaaagttggtgtctgaatatatgtccaaaaagataaaagttgatgaatttgtgactcacaatctgtcttttgatgaaatcaacaaagcctttgaactgatgcattctggaaagagcattcgaactgttgtaaagatttaa
Sequence Length
1125
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
128
Molecular Weight
39,724 Da
NCBI Official Full Name
Homo sapiens alcohol dehydrogenase 5 (class III), chi polypeptide, mRNA
NCBI Official Synonym Full Names
alcohol dehydrogenase 5 (class III), chi polypeptide
NCBI Official Symbol
ADH5
NCBI Official Synonym Symbols
FDH; ADHX; ADH-3; FALDH; GSNOR; GSH-FDH; HEL-S-60p
NCBI Protein Information
alcohol dehydrogenase class-3
UniProt Protein Name
Alcohol dehydrogenase class-3
Protein Family
UniProt Gene Name
ADH5
UniProt Synonym Gene Names
FALDH; FDH; GSH-FDH
UniProt Entry Name
ADHX_HUMAN

NCBI Description

This gene encodes a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. The encoded protein forms a homodimer. It has virtually no activity for ethanol oxidation, but exhibits high activity for oxidation of long-chain primary alcohols and for oxidation of S-hydroxymethyl-glutathione, a spontaneous adduct between formaldehyde and glutathione. This enzyme is an important component of cellular metabolism for the elimination of formaldehyde, a potent irritant and sensitizing agent that causes lacrymation, rhinitis, pharyngitis, and contact dermatitis. The human genome contains several non-transcribed pseudogenes related to this gene. [provided by RefSeq, Oct 2008]

Uniprot Description

ADH5: Class-III ADH is remarkably ineffective in oxidizing ethanol, but it readily catalyzes the oxidation of long-chain primary alcohols and the oxidation of S-(hydroxymethyl) glutathione. Belongs to the zinc-containing alcohol dehydrogenase family. Class-III subfamily.

Protein type: Lipid Metabolism - fatty acid; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Oxidoreductase; Mitochondrial; Energy Metabolism - methane; Xenobiotic Metabolism - metabolism by cytochrome P450; Xenobiotic Metabolism - drug metabolism - cytochrome P450; EC 1.1.1.1; Cofactor and Vitamin Metabolism - retinol; Amino Acid Metabolism - tyrosine; EC 1.1.1.284

Chromosomal Location of Human Ortholog: 4q23

Cellular Component: cytosol

Molecular Function: electron carrier activity; fatty acid binding; formaldehyde dehydrogenase activity; S-(hydroxymethyl)glutathione dehydrogenase activity; zinc ion binding

Biological Process: ethanol oxidation; response to redox state

Research Articles on ADH5

Similar Products

Product Notes

The ADH5 adh5 (Catalog #AAA1275495) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaacg aggttatcaa gtgcaaggct gcagttgctt gggaggctgg aaagcctctc tccatagagg agatagaggt ggcaccccca aaggctcatg aagttcgaat caagatcatt gccactgcgg tttgccacac cgatgcctat accctgagtg gagctgatcc tgagggttgt tttccagtga tcttgggaca tgaaggtgct ggaattgtgg aaagtgttgg tgagggagtt actaagctga aggcgggtga cactgtcatc ccactttaca tcccacagtg tggagaatgc aaattttgtc taaatcctaa aactaacctt tgccagaaga taagagtcac tcaagggaaa ggattaatgc cagatggtac cagcagattt acttgcaaag gaaagacaat tttgcattac atgggaacca gcacattttc tgaatacaca gttgtggctg atatctctgt tgctaaaata gatcctttag cacctttgga taaagtctgc cttctaggtt gtggcatttc aaccggttat ggtgctgctg tgaacactgc caagttggag cctggctctg tttgtgccgt ctttggtctg ggaggagtcg gattggcagt tatcatgggc tgtaaagtgg ctggtgcttc ccggatcatt ggtgtggaca tcaataaaga taaatttgca agggccaaag agtttggagc cactgaatgt attaaccctc aggattttag taaacccatc caggaagtgc tcattgagat gaccgatgga ggagtggact attcctttga atgtattggt aatgtgaagg tcatgagagc agcacttgag gcatgtcaca agggctgggg cgtcagcgtc gtggttggag tagctgcttc aggtgaagaa attgccactc gtccattcca gctggtaaca ggtcgcacat ggaaaggcac tgcctttgga ggatggaaga gtgtagaaag tgtcccaaag ttggtgtctg aatatatgtc caaaaagata aaagttgatg aatttgtgac tcacaatctg tcttttgatg aaatcaacaa agcctttgaa ctgatgcatt ctggaaagag cattcgaact gttgtaaaga tttaa. It is sometimes possible for the material contained within the vial of "ADH5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.