Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACVRL1 cdna clone

ACVRL1 cDNA Clone

Gene Names
ACVRL1; HHT; ALK1; HHT2; ORW2; SKR3; ALK-1; TSR-I; ACVRLK1
Synonyms
ACVRL1; ACVRL1 cDNA Clone; ACVRL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccttgggctcccccaggaaaggccttctgatgctgctgatggccttggtgacccagggagaccctgtgaagccgtctcggggcccgctggtgacctgcacgtgtgagagcccacattgcaaggggcctacctgccggggggcctggtgcacagtagtgctggtgcgggaggaggggaggcacccccaggaacatcggggctgcgggaacttgcacagggagctctgcagggggcgccccaccgagttcgtcaaccactactgctgcgacagccacctctgcaaccacaacgtgtccctggtgctggaggccacccaacctccttcggagcagccgggaacagatggccagctggccctgatcctgggccccgtgctggccttgctggccctggtggccctgggtgtcctgggcctgtggcatgtccgacggaggcaggagaagcagcgtggcctgcacagcgagctgggagagtccagtctcatcctgaaagcatctgagcagggcgacagcatgttgggggacctcctggacagtgactgcaccacagggagtggctcagggctccccttcctggtgcagaggacagtggcacggcaggttgccttggtggagtgtgtgggaaaaggccgctatggcgaagtgtggcggggcttgtggcacggtgagagtgtggccgtcaagatcttctcctcgagggatgaacagtcctggttccgggagactgagatctataacacagtgttgctcagacacgacaacatcctaggcttcatcgcctcagacatgacctcccgcaactcgagcacgcagctgtggctcatcacgcactaccacgagcacggctccctctacgactttctgcagagacagacgctggagccccatctggctctgaggctagctgtgtccgcggcatgcggcctggcgcacctgcacgtggagatcttcggtacacagggcaaaccagccattgcccaccgcgacttcaagagccgcaatgtgctggtcaagagcaacctgcagtgttgcatcgccgacctgggcctggctgtgatgcactcacagggcagcgattacctggacatcggcaacaacccgagagtgggcaccaagcggtacatggcacccgaggtgctggacgagcagatccgcacggactgctttgagtcctacaagtggactgacatctgggcctttggcctggtgctgtgggagattgcccgccggaccatcgtgaatggcatcgtggaggactatagaccacccttctatgatgtggtgcccaatgaccccagctttgaggacatgaagaaggtggtgtgtgtggatcagcagacccccaccatccctaaccggctggctgcagacccggtcctctcaggcctagctcagatgatgcgggagtgctggtacccaaacccctctgcccgactcaccgcgctgcggatcaagaagacactacaaaaaattagcaacagtccagagaagcctaaagtgattcaatag
Sequence Length
1512
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
94
Molecular Weight
56,124 Da
NCBI Official Full Name
Homo sapiens activin A receptor type II-like 1, mRNA
NCBI Official Synonym Full Names
activin A receptor like type 1
NCBI Official Symbol
ACVRL1
NCBI Official Synonym Symbols
HHT; ALK1; HHT2; ORW2; SKR3; ALK-1; TSR-I; ACVRLK1
NCBI Protein Information
serine/threonine-protein kinase receptor R3
UniProt Protein Name
Serine/threonine-protein kinase receptor R3
UniProt Gene Name
ACVRL1
UniProt Synonym Gene Names
ACVRLK1; ALK1; SKR3; ALK-1; TSR-I
UniProt Entry Name
ACVL1_HUMAN

NCBI Description

This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]

Uniprot Description

ALK1: a kinase of the STKR family. A type I cell-surface receptor for the TGF-beta superfamily of ligands including Activin A. Highly expressed in human placenta and lung. Deficiency causes hemorrhagic telangiectasia type 2 also known as Rendu-Osler-Weber syndrome 2.

Protein type: Protein kinase, TKL; Membrane protein, integral; Kinase, protein; Protein kinase, Ser/Thr (receptor); EC 2.7.11.30; TKL group; STKR family; Type1 subfamily

Chromosomal Location of Human Ortholog: 12q13.13

Cellular Component: cell surface; integral to plasma membrane; plasma membrane

Molecular Function: activin binding; activin receptor activity, type I; ATP binding; protein binding; protein kinase binding; protein serine/threonine kinase activity; SMAD binding; transforming growth factor beta binding; transforming growth factor beta receptor activity; transforming growth factor beta receptor activity, type I

Biological Process: angiogenesis; blood circulation; blood vessel endothelial cell proliferation during sprouting angiogenesis; blood vessel maturation; blood vessel remodeling; BMP signaling pathway; lymphangiogenesis; negative regulation of blood vessel endothelial cell migration; negative regulation of cell adhesion; negative regulation of cell growth; negative regulation of cell migration; negative regulation of cell proliferation; negative regulation of focal adhesion formation; positive regulation of BMP signaling pathway; positive regulation of chondrocyte differentiation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein amino acid phosphorylation; regulation of blood pressure; regulation of blood vessel endothelial cell migration; regulation of DNA replication; regulation of endothelial cell proliferation; regulation of transcription, DNA-dependent; signal transduction; transforming growth factor beta receptor signaling pathway; wound healing, spreading of epidermal cells

Disease: Telangiectasia, Hereditary Hemorrhagic, Type 2

Research Articles on ACVRL1

Similar Products

Product Notes

The ACVRL1 acvrl1 (Catalog #AAA1272314) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccttgg gctcccccag gaaaggcctt ctgatgctgc tgatggcctt ggtgacccag ggagaccctg tgaagccgtc tcggggcccg ctggtgacct gcacgtgtga gagcccacat tgcaaggggc ctacctgccg gggggcctgg tgcacagtag tgctggtgcg ggaggagggg aggcaccccc aggaacatcg gggctgcggg aacttgcaca gggagctctg cagggggcgc cccaccgagt tcgtcaacca ctactgctgc gacagccacc tctgcaacca caacgtgtcc ctggtgctgg aggccaccca acctccttcg gagcagccgg gaacagatgg ccagctggcc ctgatcctgg gccccgtgct ggccttgctg gccctggtgg ccctgggtgt cctgggcctg tggcatgtcc gacggaggca ggagaagcag cgtggcctgc acagcgagct gggagagtcc agtctcatcc tgaaagcatc tgagcagggc gacagcatgt tgggggacct cctggacagt gactgcacca cagggagtgg ctcagggctc cccttcctgg tgcagaggac agtggcacgg caggttgcct tggtggagtg tgtgggaaaa ggccgctatg gcgaagtgtg gcggggcttg tggcacggtg agagtgtggc cgtcaagatc ttctcctcga gggatgaaca gtcctggttc cgggagactg agatctataa cacagtgttg ctcagacacg acaacatcct aggcttcatc gcctcagaca tgacctcccg caactcgagc acgcagctgt ggctcatcac gcactaccac gagcacggct ccctctacga ctttctgcag agacagacgc tggagcccca tctggctctg aggctagctg tgtccgcggc atgcggcctg gcgcacctgc acgtggagat cttcggtaca cagggcaaac cagccattgc ccaccgcgac ttcaagagcc gcaatgtgct ggtcaagagc aacctgcagt gttgcatcgc cgacctgggc ctggctgtga tgcactcaca gggcagcgat tacctggaca tcggcaacaa cccgagagtg ggcaccaagc ggtacatggc acccgaggtg ctggacgagc agatccgcac ggactgcttt gagtcctaca agtggactga catctgggcc tttggcctgg tgctgtggga gattgcccgc cggaccatcg tgaatggcat cgtggaggac tatagaccac ccttctatga tgtggtgccc aatgacccca gctttgagga catgaagaag gtggtgtgtg tggatcagca gacccccacc atccctaacc ggctggctgc agacccggtc ctctcaggcc tagctcagat gatgcgggag tgctggtacc caaacccctc tgcccgactc accgcgctgc ggatcaagaa gacactacaa aaaattagca acagtccaga gaagcctaaa gtgattcaat ag. It is sometimes possible for the material contained within the vial of "ACVRL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.