Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACTN1 cdna clone

ACTN1 cDNA Clone

Gene Names
ACTN1; BDPLT15
Synonyms
ACTN1; ACTN1 cDNA Clone; ACTN1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaccattatgattctcagcaaaccaacgattacatgcagccagaagaggactgggaccgggacctgctcctggacccggcctgggagaagcagcagagaaagacattcacggcatggtgtaactcccacctccggaaggcggggacacagatcgagaacatcgaagaggacttccgggatggcctgaagctcatgctgctgctggaggtcatctcaggtgaacgcttggccaagccagagcgaggcaagatgagagtgcacaagatctccaacgtcaacaaggccctggatttcatagccagcaaaggcgtcaaactggtgtccatcggagccgaagaaatcgtggatgggaatgtgaagatgaccctgggcatgatctggaccatcatcctgcgctttgccatccaggacatctccgtggaagagacttcagccaaggaagggctgctcctgtggtgtcagagaaagacagccccttacaaaaatgtcaacatccagaacttccacataagctggaaggatggcctcggcttctgtgctttgatccaccgacaccggcccgagctgattgactacgggaagctgcggaaggatgatccactcacaaatctgaatacggcttttgacgtggcagagaagtacctggacatccccaagatgctggatgccgaagacatcgttggaactgcccgaccggatgagaaagccatcatgacttacgtgtctagcttctaccacgccttctctggagcccagaaggcggagacagcagccaatcgcatctgcaaggtgttggccgtcaaccaggagaacgagcagcttatggaagactacgagaagctggccagtgatctgttggagtggatccgccgcacaatcccgtggctggagaaccgggtgcccgagaacaccatgcatgccatgcaacagaagctggaggacttccgggactaccggcgcctgcacaagccgcccaaggtgcaggagaagtgccagctggagatcaacttcaacacgctgcagaccaagctgcggctcagcaaccggcctgccttcatgccctctgagggcaggatggtctcggacatcaacaatgcctggggctgcctggagcaggtggagaagggctatgaggagtggttgctgaatgagatccggaggctggagcgactggaccacctggcagagaagttccggcagaaggcctccatccacgaggcctggactgacggcaaagaggccatgctgcgacagaaggactatgagaccgccaccctctcggagatcaaggccctgctcaagaagcatgaggccttcgagagtgacctggctgcccaccaggaccgtgtggagcagattgccgccatcgcacaggagctcaatgagctggactattatgactcacccagtgtcaacgcccgttgccaaaagatctgtgaccagtgggacaatctgggggccctaactcagaagcgaagggaagctctggagcggaccgagaaactgctggagaccattgaccagctgtacttggagtatgccaagcgggctgcacccttcaacaactggatggagggggccatggaggacctgcaggacaccttcattgtgcacaccattgaggagatccagggactgaccacagcccatgagcagttcaaggccaccctccctgatgccgacaaggagcgcctggccatcctgggcatccacaatgaggtgtccaagattgtccagacctaccacgtcaatatggcgggcaccaacccctacacaaccatcacgcctcaggagatcaatggcaaatgggaccacgtgcggcagctggtgcctcggagggaccaagctctgacggaggagcatgcccgacagcagcacaatgagaggctacgcaagcagtttggagcccaggccaatgtcatcgggccctggatccagaccaagatggaggagatcgggaggatctccattgagatgcatgggaccctggaggaccagctcagccacctgcggcagtatgagaagagcatcgtcaactacaagccaaagattgatcagctggagggcgaccaccagctcatccaggaggcgctcatcttcgacaacaagcacaccaactacaccatggagcacatccgtgtgggctgggagcagctgctcaccaccatcgccaggaccatcaatgaggtagagaaccagatcctgacccgggatgccaagggcatcagccaggagcagatgaatgagttccgggcctccttcaaccactttgaccgggatcactccggcacactgggtcccgaggagttcaaagcctgcctcatcagcttgggttatgatattggcaacgacccccagggagaagcagaatttgcccgcatcatgagcattgtggaccccaaccgcctgggggtagtgacattccaggccttcattgacttcatgtcccgcgagacagccgacacagatacagcagaccaagtcatggcttccttcaagatcctggctggggacaagaactacattaccatggacgagctgcgccgcgagctgccacccgaccaggctgagtactgcatcgcgcggatggccccctacaccggccccgactccgtgccaggtgctctggactacatgtccttctccacggcgctgtacggcgagagtgacctctaa
Sequence Length
2679
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
87
Molecular Weight
107,141 Da
NCBI Official Full Name
Homo sapiens actinin, alpha 1, mRNA
NCBI Official Synonym Full Names
actinin alpha 1
NCBI Official Symbol
ACTN1
NCBI Official Synonym Symbols
BDPLT15
NCBI Protein Information
alpha-actinin-1
UniProt Protein Name
Alpha-actinin-1
Protein Family
UniProt Gene Name
ACTN1
UniProt Entry Name
ACTN1_HUMAN

NCBI Description

Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ACTN1: a cytoskeletal protein of the spectrin superfamily. An actin-binding protein with multiple roles in different cell types. A nonmuscle isoform structurally similar to the erythroid beta spectrin gene.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 14q24|14q22-q24

Cellular Component: actin filament; cell projection; cytoplasm; cytosol; extracellular region; extracellular space; focal adhesion; intercellular junction; intracellular; pseudopodium; ruffle; stress fiber

Molecular Function: actin filament binding; double-stranded RNA binding; integrin binding; ligand-dependent nuclear receptor transcription coactivator activity; protein binding; protein homodimerization activity; vinculin binding

Biological Process: actin filament network formation; actin filament organization; focal adhesion formation; negative regulation of cell motility; platelet activation; platelet degranulation; platelet formation

Disease: Bleeding Disorder, Platelet-type, 15

Research Articles on ACTN1

Similar Products

Product Notes

The ACTN1 actn1 (Catalog #AAA1266936) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccatt atgattctca gcaaaccaac gattacatgc agccagaaga ggactgggac cgggacctgc tcctggaccc ggcctgggag aagcagcaga gaaagacatt cacggcatgg tgtaactccc acctccggaa ggcggggaca cagatcgaga acatcgaaga ggacttccgg gatggcctga agctcatgct gctgctggag gtcatctcag gtgaacgctt ggccaagcca gagcgaggca agatgagagt gcacaagatc tccaacgtca acaaggccct ggatttcata gccagcaaag gcgtcaaact ggtgtccatc ggagccgaag aaatcgtgga tgggaatgtg aagatgaccc tgggcatgat ctggaccatc atcctgcgct ttgccatcca ggacatctcc gtggaagaga cttcagccaa ggaagggctg ctcctgtggt gtcagagaaa gacagcccct tacaaaaatg tcaacatcca gaacttccac ataagctgga aggatggcct cggcttctgt gctttgatcc accgacaccg gcccgagctg attgactacg ggaagctgcg gaaggatgat ccactcacaa atctgaatac ggcttttgac gtggcagaga agtacctgga catccccaag atgctggatg ccgaagacat cgttggaact gcccgaccgg atgagaaagc catcatgact tacgtgtcta gcttctacca cgccttctct ggagcccaga aggcggagac agcagccaat cgcatctgca aggtgttggc cgtcaaccag gagaacgagc agcttatgga agactacgag aagctggcca gtgatctgtt ggagtggatc cgccgcacaa tcccgtggct ggagaaccgg gtgcccgaga acaccatgca tgccatgcaa cagaagctgg aggacttccg ggactaccgg cgcctgcaca agccgcccaa ggtgcaggag aagtgccagc tggagatcaa cttcaacacg ctgcagacca agctgcggct cagcaaccgg cctgccttca tgccctctga gggcaggatg gtctcggaca tcaacaatgc ctggggctgc ctggagcagg tggagaaggg ctatgaggag tggttgctga atgagatccg gaggctggag cgactggacc acctggcaga gaagttccgg cagaaggcct ccatccacga ggcctggact gacggcaaag aggccatgct gcgacagaag gactatgaga ccgccaccct ctcggagatc aaggccctgc tcaagaagca tgaggccttc gagagtgacc tggctgccca ccaggaccgt gtggagcaga ttgccgccat cgcacaggag ctcaatgagc tggactatta tgactcaccc agtgtcaacg cccgttgcca aaagatctgt gaccagtggg acaatctggg ggccctaact cagaagcgaa gggaagctct ggagcggacc gagaaactgc tggagaccat tgaccagctg tacttggagt atgccaagcg ggctgcaccc ttcaacaact ggatggaggg ggccatggag gacctgcagg acaccttcat tgtgcacacc attgaggaga tccagggact gaccacagcc catgagcagt tcaaggccac cctccctgat gccgacaagg agcgcctggc catcctgggc atccacaatg aggtgtccaa gattgtccag acctaccacg tcaatatggc gggcaccaac ccctacacaa ccatcacgcc tcaggagatc aatggcaaat gggaccacgt gcggcagctg gtgcctcgga gggaccaagc tctgacggag gagcatgccc gacagcagca caatgagagg ctacgcaagc agtttggagc ccaggccaat gtcatcgggc cctggatcca gaccaagatg gaggagatcg ggaggatctc cattgagatg catgggaccc tggaggacca gctcagccac ctgcggcagt atgagaagag catcgtcaac tacaagccaa agattgatca gctggagggc gaccaccagc tcatccagga ggcgctcatc ttcgacaaca agcacaccaa ctacaccatg gagcacatcc gtgtgggctg ggagcagctg ctcaccacca tcgccaggac catcaatgag gtagagaacc agatcctgac ccgggatgcc aagggcatca gccaggagca gatgaatgag ttccgggcct ccttcaacca ctttgaccgg gatcactccg gcacactggg tcccgaggag ttcaaagcct gcctcatcag cttgggttat gatattggca acgaccccca gggagaagca gaatttgccc gcatcatgag cattgtggac cccaaccgcc tgggggtagt gacattccag gccttcattg acttcatgtc ccgcgagaca gccgacacag atacagcaga ccaagtcatg gcttccttca agatcctggc tggggacaag aactacatta ccatggacga gctgcgccgc gagctgccac ccgaccaggc tgagtactgc atcgcgcgga tggcccccta caccggcccc gactccgtgc caggtgctct ggactacatg tccttctcca cggcgctgta cggcgagagt gacctctaa. It is sometimes possible for the material contained within the vial of "ACTN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.