ACOT4 cdna clone
ACOT4 cDNA Clone
Gene Names
ACOT4; PTE1B; PTE2B; PTE-Ib
Synonyms
ACOT4; ACOT4 cDNA Clone; ACOT4 cdna clone
Sequence
atgtcagcaacgctgatcctggagcccccaggccgctgctgctggaacgagccggtgcgcattgccgtgcgcggcctggccccggagcagcgggttacgctgcgcgcgtccctgcgcgacgagaagggcgcgctcttccgggcccacgcgcgctactgcgccgacgcccgcggcgagctggacctggagcgcgcacccgcgctgggcggcagcttcgcgggactcgagcccatggggctgctctgggccctggaacccgagaagcctttttggcgcttcctgaagcgggacgtacagattccttttgtcgtggagttggaggtgctggacggccacgaccccgagcctggacggctgctgtgccaggcgcagcacgagcgccacttcctcccgccaggggtgcggcgccagtcggtgcgagcgggccgggtgcgcgccacgctcttcctgccgccaggacctggacccttcccagggatcattgacatctttggtattggagggggcctcttggaatatcgagccagcctccttgctggccatggctttgccacgttggctctagcttattataactttgaagatctccccaataacatggacaacatatccctggagtacttcgaagaagccgtatgctacatgcttcaacatccccaggtaaaaggcccaggcattgggcttttgggcatttctctaggagctgatatttgtctctcaatggcctcattcttgaagaatgtctcagccacagtttccatcaatggatctgggatcagtgggaacacagccatcaactataagcacagtagcattccaccattgggctatgacctgaggagaatcaaggtagctttctcaggcctcgtggacattgtggatataaggaatgctctcgtaggagggtacaagaaccccagcatgattccaatagagaaggcccaggggcccatcctgctcattgttggtcaggatgaccataactggagaagtgagttgtatgcccaaacagtctctgaacggttacaggcccatggaaaggaaaaaccccagatcatctgttaccctgggactgggcattacatcgagcctccttacttccccctgtgcccagcttcccttcacagattactgaacaaacatgttatatggggtggggagcccagggctcattctaaggcccaggaagatgcctggaagcaaattctagccttcttctgcaaacacctgggaggtacccagaaaacagctgtccctaaattgtaa
Sequence Length
1266
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,327 Da
NCBI Official Full Name
Homo sapiens acyl-CoA thioesterase 4, mRNA
NCBI Official Synonym Full Names
acyl-CoA thioesterase 4
NCBI Official Symbol
ACOT4
NCBI Official Synonym Symbols
PTE1B; PTE2B; PTE-Ib
NCBI Protein Information
acyl-coenzyme A thioesterase 4
UniProt Protein Name
Acyl-coenzyme A thioesterase 4
Protein Family
UniProt Gene Name
ACOT4
UniProt Synonym Gene Names
PTE2B; PTEIB; Acyl-CoA thioesterase 4; PTE-Ib
UniProt Entry Name
ACOT4_HUMAN
Uniprot Description
ACOT4: Acyl-CoA thioesterases are a group of enzymes that catalyze the hydrolysis of acyl-CoAs to the free fatty acid and coenzyme A (CoASH), providing the potential to regulate intracellular levels of acyl-CoAs, free fatty acids and CoASH. Succinyl-CoA thioesterase that also hydrolyzes long chain saturated and unsaturated monocarboxylic acyl-CoAs. Belongs to the C/M/P thioester hydrolase family.
Protein type: Lipid Metabolism - unsaturated fatty acid biosynthesis; Hydrolase; EC 3.1.2.2
Chromosomal Location of Human Ortholog: 14q24.3
Cellular Component: peroxisomal matrix; peroxisome
Molecular Function: acyl-CoA hydrolase activity; receptor binding; succinyl-CoA hydrolase activity
Biological Process: acyl-CoA metabolic process; butyrate metabolic process; dicarboxylic acid catabolic process; dicarboxylic acid metabolic process; long-chain fatty acid metabolic process; saturated monocarboxylic acid metabolic process; short-chain fatty acid metabolic process; succinyl-CoA metabolic process; unsaturated monocarboxylic acid metabolic process; very-long-chain fatty acid metabolic process
Research Articles on ACOT4
Similar Products
Product Notes
The ACOT4 acot4 (Catalog #AAA1270909) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagcaa cgctgatcct ggagccccca ggccgctgct gctggaacga gccggtgcgc attgccgtgc gcggcctggc cccggagcag cgggttacgc tgcgcgcgtc cctgcgcgac gagaagggcg cgctcttccg ggcccacgcg cgctactgcg ccgacgcccg cggcgagctg gacctggagc gcgcacccgc gctgggcggc agcttcgcgg gactcgagcc catggggctg ctctgggccc tggaacccga gaagcctttt tggcgcttcc tgaagcggga cgtacagatt ccttttgtcg tggagttgga ggtgctggac ggccacgacc ccgagcctgg acggctgctg tgccaggcgc agcacgagcg ccacttcctc ccgccagggg tgcggcgcca gtcggtgcga gcgggccggg tgcgcgccac gctcttcctg ccgccaggac ctggaccctt cccagggatc attgacatct ttggtattgg agggggcctc ttggaatatc gagccagcct ccttgctggc catggctttg ccacgttggc tctagcttat tataactttg aagatctccc caataacatg gacaacatat ccctggagta cttcgaagaa gccgtatgct acatgcttca acatccccag gtaaaaggcc caggcattgg gcttttgggc atttctctag gagctgatat ttgtctctca atggcctcat tcttgaagaa tgtctcagcc acagtttcca tcaatggatc tgggatcagt gggaacacag ccatcaacta taagcacagt agcattccac cattgggcta tgacctgagg agaatcaagg tagctttctc aggcctcgtg gacattgtgg atataaggaa tgctctcgta ggagggtaca agaaccccag catgattcca atagagaagg cccaggggcc catcctgctc attgttggtc aggatgacca taactggaga agtgagttgt atgcccaaac agtctctgaa cggttacagg cccatggaaa ggaaaaaccc cagatcatct gttaccctgg gactgggcat tacatcgagc ctccttactt ccccctgtgc ccagcttccc ttcacagatt actgaacaaa catgttatat ggggtgggga gcccagggct cattctaagg cccaggaaga tgcctggaag caaattctag ccttcttctg caaacacctg ggaggtaccc agaaaacagc tgtccctaaa ttgtaa. It is sometimes possible for the material contained within the vial of "ACOT4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
