ACAP1 cdna clone
ACAP1 cDNA Clone
Gene Names
ACAP1; CENTB1
Synonyms
ACAP1; ACAP1 cDNA Clone; ACAP1 cdna clone
Sequence
atgacggtcaagctggatttcgaggagtgtctcaaggactcaccccgtttccgagcctctattgagctggtggaagccgaagtgtcagaattggagacccgtctggaaaagctcctgaaactgggcactggtctcctggaaagtgggcgccattaccttgctgccagccgcgccttcgttgtcggcatttgtgacctggcccgcctgggtccaccagagcccatgatggcggagtgtctggaaaaattcaccgtgagcctgaaccacaagctggacagccatgcggagcttctagatgccacccaacacacactgcagcagcagatccagaccctggtcaaggaaggtctgcggggtttccgagaggctcgccgggatttctggcggggggctgagagcctggaggctgccctgacccacaacgcagaggttcccaggcgccgggcccaggaggcagaagaggcaggagctgctttgaggacggctcgagctgggtaccggggacgggcactggattatgccctgcagatcaacgtgattgaggacaagaggaagtttgacatcatggagtttgtgctgcgtttggtggaggcccaggctacccatttccagcagggccatgaggagctgagccggctgtcccagtatcgaaaggagctgggcgcccagttgcaccagctggtcttgaattcagcacgagagaagagggacatggagcagagacacgtgctgctgaaacagaaggagctgggtggggaggagccagaaccaagcttaagagaggggcctggtggcctggtgatggaaggacatctcttcaaacgggccagcaacgcatttaagacctggagcagacgctggttcaccattcagagcaaccaactggtttaccagaagaagtacaaggaccctgtgactgtggtggtggatgaccttcgtctctgcacagtgaaactctgccctgactcagaaaggcggttctgctttgaggtggtgtccaccagcaagtcctgcctcctccaggctgactcagagcgcctcctgcagctgtgggtcagtgctgtgcagagcagcattgcttctgccttcagtcaggctcgccttgatgacagcccccggggtccaggccagggctcaggacacctggccataggctctgctgccaccctgggctctggtggaatggccaggggaagggagcctgggggagtcgggcacgtggtggcccaggtccagagtgtggatggcaatgcccagtgctgcgactgccgggagccagccccggagtgggccagcatcaaccttggtgtcaccctctgcattcagtgttccggcatccacaggagccttggtgttcacttctccaaagtccggtctctgacccttgactcatgggagccagaactagtgaagctcatgtgtgagctgggaaatgtcatcatcaaccagatctatgaggcccgcgtggaggccatggcagtgaagaaaccagggcccagctgctcccggcaggagaaggaggcctggattcacgctaaatacgtggagaagaagttcctgaccaagctgcctgagattcgagggcgaagaggtggccgggggcgcccaagggggcagcctcctgtgcccccaaagccttccatcaggccccggccagggagcttgagatccaagccagagcccccctctgaggacctgggaagcctgcaccctggggccctactgtttcgagcgtctgggcatcctccatctcttcccaccatggctgatgcccttgcccatggagctgatgtcaactgggtcaatgggggccaagataatgccacaccgctgatccaggccacagctgctaattctcttctggcctgtgagtttctcctccagaacggggcgaacgtgaaccaagcggacagtgcgggccggggcccgctgcaccacgcaaccattcttggccacacggggctcgcctgcctgttcctgaaacggggagctgatctgggggctcgagactctgaaggcagggaccctctgaccatcgccatggaaacagccaacgctgacatcgtcaccctgctacgactggcaaagatgagggaggctgaagcggcccaggggcaggcaggagatgagacgtatcttgacatcttccgcgacttctccctcatggcgtcagacgacccggagaagctgagccgtcgcagtcatgacctccacacgctgtga
Sequence Length
2223
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
81,536 Da
NCBI Official Full Name
Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 1, mRNA
NCBI Official Synonym Full Names
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
NCBI Official Symbol
ACAP1
NCBI Official Synonym Symbols
CENTB1
NCBI Protein Information
arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 1
UniProt Protein Name
Arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 1
UniProt Gene Name
ACAP1
UniProt Synonym Gene Names
CENTB1; KIAA0050; Cnt-b1
UniProt Entry Name
ACAP1_HUMAN
Uniprot Description
CENTB1: a member of the centaurin family of ADP-ribosylation factor directed GTPase-activating proteins (GAPs). A GAP for ARF1 and ARF5. Two alternatively-spliced isoforms have been described. Isoform 1 is brain-specific, and isoform 2 is ubiquitously expressed, with highest levels in brain and heart. Isoform 1 participates to the prevention of neuronal apoptosis by enhancing PI3 kinase activity. It aids the coupling of metabotropic glutamate receptor 1 (GRM1) to cytoplasmic PI3 kinase by interacting with Homer scaffolding proteins, and also seems to mediate anti-apoptotic effects of NGF by activating nuclear PI3 kinase. Isoform 2 does not stimulate PI3 kinase but may protect cells from apoptosis by stimulating Akt. Regulates the adapter protein 1 (AP-1)-dependent trafficking of proteins in the endosomal system. The PH domains of isoforms 1 and 2 bind phospholipids, but they differentially regulate subcellular location. The PH domain of isoform 1 directs the protein to the nucleus, but the PH domain of isoform 2 directs it to the cytosol.
Protein type: GAPs; Motility/polarity/chemotaxis; GAPs, ARF
Chromosomal Location of Human Ortholog: 17p13.1
Cellular Component: membrane
Molecular Function: protein binding
Research Articles on ACAP1
Similar Products
Product Notes
The ACAP1 acap1 (Catalog #AAA1269946) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggtca agctggattt cgaggagtgt ctcaaggact caccccgttt ccgagcctct attgagctgg tggaagccga agtgtcagaa ttggagaccc gtctggaaaa gctcctgaaa ctgggcactg gtctcctgga aagtgggcgc cattaccttg ctgccagccg cgccttcgtt gtcggcattt gtgacctggc ccgcctgggt ccaccagagc ccatgatggc ggagtgtctg gaaaaattca ccgtgagcct gaaccacaag ctggacagcc atgcggagct tctagatgcc acccaacaca cactgcagca gcagatccag accctggtca aggaaggtct gcggggtttc cgagaggctc gccgggattt ctggcggggg gctgagagcc tggaggctgc cctgacccac aacgcagagg ttcccaggcg ccgggcccag gaggcagaag aggcaggagc tgctttgagg acggctcgag ctgggtaccg gggacgggca ctggattatg ccctgcagat caacgtgatt gaggacaaga ggaagtttga catcatggag tttgtgctgc gtttggtgga ggcccaggct acccatttcc agcagggcca tgaggagctg agccggctgt cccagtatcg aaaggagctg ggcgcccagt tgcaccagct ggtcttgaat tcagcacgag agaagaggga catggagcag agacacgtgc tgctgaaaca gaaggagctg ggtggggagg agccagaacc aagcttaaga gaggggcctg gtggcctggt gatggaagga catctcttca aacgggccag caacgcattt aagacctgga gcagacgctg gttcaccatt cagagcaacc aactggttta ccagaagaag tacaaggacc ctgtgactgt ggtggtggat gaccttcgtc tctgcacagt gaaactctgc cctgactcag aaaggcggtt ctgctttgag gtggtgtcca ccagcaagtc ctgcctcctc caggctgact cagagcgcct cctgcagctg tgggtcagtg ctgtgcagag cagcattgct tctgccttca gtcaggctcg ccttgatgac agcccccggg gtccaggcca gggctcagga cacctggcca taggctctgc tgccaccctg ggctctggtg gaatggccag gggaagggag cctgggggag tcgggcacgt ggtggcccag gtccagagtg tggatggcaa tgcccagtgc tgcgactgcc gggagccagc cccggagtgg gccagcatca accttggtgt caccctctgc attcagtgtt ccggcatcca caggagcctt ggtgttcact tctccaaagt ccggtctctg acccttgact catgggagcc agaactagtg aagctcatgt gtgagctggg aaatgtcatc atcaaccaga tctatgaggc ccgcgtggag gccatggcag tgaagaaacc agggcccagc tgctcccggc aggagaagga ggcctggatt cacgctaaat acgtggagaa gaagttcctg accaagctgc ctgagattcg agggcgaaga ggtggccggg ggcgcccaag ggggcagcct cctgtgcccc caaagccttc catcaggccc cggccaggga gcttgagatc caagccagag cccccctctg aggacctggg aagcctgcac cctggggccc tactgtttcg agcgtctggg catcctccat ctcttcccac catggctgat gcccttgccc atggagctga tgtcaactgg gtcaatgggg gccaagataa tgccacaccg ctgatccagg ccacagctgc taattctctt ctggcctgtg agtttctcct ccagaacggg gcgaacgtga accaagcgga cagtgcgggc cggggcccgc tgcaccacgc aaccattctt ggccacacgg ggctcgcctg cctgttcctg aaacggggag ctgatctggg ggctcgagac tctgaaggca gggaccctct gaccatcgcc atggaaacag ccaacgctga catcgtcacc ctgctacgac tggcaaagat gagggaggct gaagcggccc aggggcaggc aggagatgag acgtatcttg acatcttccg cgacttctcc ctcatggcgt cagacgaccc ggagaagctg agccgtcgca gtcatgacct ccacacgctg tga. It is sometimes possible for the material contained within the vial of "ACAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
