ACADSB cdna clone

ACADSB cDNA Clone

Cat. Num. AAA1266563

• Gene Names: ACADSB; ACAD7; SBCAD; 2-MEBCAD
• Synonyms: ACADSB; ACADSB cDNA Clone; ACADSB cdna clone

• Sequence: atggagggcctggcagtgcggttgctgcgcggcagcaagctgctaagaagaaatttcctgacttgtttgtcttcttggaagattcctcctcatgtctcaaaatcttcccagtcagaagctctactcaatataacaaataatggaatacactttgctcccctgcaaacatttacagatgaggaaatgatgataaagagttcagttaaaaaatttgctcaggaacaaattgcacctttggtttcaaccatggatgaaaattcgaaaatggagaaatcagtaatacaaggattatttcaacaagggttgatgggtattgaagttgacccagaatatggaggcacaggagcttcatttttatccactgtgctcgtgatagaggaattagccaaagttgatgcatctgtggctgtcttttgtgagatccagaacacattaattaacacactgattagaaaacatggaacagaagaacaaaaggccacctatttgcctcagctcactacagaaaaagtaggaagtttctgcctttcagaggctggagcaggtagtgactcatttgctttgaagaccagagctgataaagagggagattattatgtcctcaatggatcaaagatgtggatcagcagtgctgagcacgcagggctctttctggtgatggcaaatgtagaccctaccattggatataagggaattacctccttcttagtagatcgtgatactccgggccttcatatagggaaacctgaaaacaaattggggctcagagcttcttccacctgcccgttaacattcgaaaatgtcaaggttccagaagccaatatcttgggacaaattggacatggctataagtatgccatagggagtctcaatgaaggtagaataggaattgctgcacagatgctgggactggcgcaaggatgttttgactacactattccatatattaaagaaaggatacaatttggcaaaagactatttgattttcagggcctccaacaccaagtggctcacgtggccacccagctggaagctgcaagattactaacatacaatgctgctaggcttttagaagctggaaagccattcataaaagaagcgtcaatggccaaatactatgcatcagagattgcaggacaaacaacgagtaaatgtatcgagtggatggggggagtaggctacaccaaagattaccctgtggagaaatacttccgagatgcaaagattggtacgatatatgaaggagcttccaacatccagttgaacaccattgcaaagcatatcgatgcagaatactga
• Sequence Length: 1299

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 15559224
• NCBI GeneID: 36
• Molecular Weight: 36,025 Da
• NCBI Official Full Name: Homo sapiens acyl-Coenzyme A dehydrogenase, short/branched chain, mRNA
• NCBI Official Synonym Full Names: acyl-CoA dehydrogenase, short/branched chain
• NCBI Official Symbol: ACADSB
• NCBI Official Synonym Symbols: ACAD7; SBCAD; 2-MEBCAD
• NCBI Protein Information: short/branched chain specific acyl-CoA dehydrogenase, mitochondrial
• UniProt Protein Name: Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial
• Protein Family: Short/branched chain specific acyl-CoA dehydrogenase
• UniProt Gene Name: ACADSB
• UniProt Synonym Gene Names: SBCAD; 2-MEBCAD; 2-methylbutyryl-CoA dehydrogenase
• UniProt Entry Name: ACDSB_HUMAN

NCBI Description

Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]

Uniprot Description

ACADSB: Has greatest activity toward short branched chain acyl- CoA derivative such as (s)-2-methylbutyryl-CoA, isobutyryl-CoA, and 2-methylhexanoyl-CoA as well as toward short straight chain acyl-CoAs such as butyryl-CoA and hexanoyl-CoA. Can use valproyl- CoA as substrate and may play a role in controlling the metabolic flux of valproic acid in the development of toxicity of this agent. Defects in ACADSB are the cause of short/branched-chain acyl-CoA dehydrogenase deficiency (SBCADD); also known as 2-methylbutyryl-CoA dehydrogenase deficiency or 2- methylbutyryl glycinuria. SBCADD is an autosomal recessive disorder and consists of a defect in catabolism of L-isoleucine which is characterized by an increase of 2-methylbutyrylglycine and 2-methylbutyrylcarnitine in blood and urine. Affected individuals have seizures and psychomotor delay as the main clinical features. Belongs to the acyl-CoA dehydrogenase family.

Protein type: Amino Acid Metabolism - valine, leucine and isoleucine degradation; EC 1.3.8.5; Oxidoreductase; Mitochondrial; Lipid Metabolism - fatty acid

Chromosomal Location of Human Ortholog: 10q26.13

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding

Biological Process: branched chain family amino acid catabolic process; fatty acid beta-oxidation using acyl-CoA dehydrogenase; fatty acid metabolic process; lipid homeostasis

Disease: 2-methylbutyryl-coa Dehydrogenase Deficiency