ABP1 cdna clone
ABP1 cDNA Clone
Gene Names
AOC1; ABP; DAO; KAO; ABP1; DAO1
Synonyms
ABP1; ABP1 cDNA Clone; ABP1 cdna clone
Sequence
atgccggccctgggctgggccgtggctgccatcctgatgctgcagacggccatggcggagccctccccggggactctgcccaggaaggcaggggtgttttcagacctaagcaaccaagagctgaaggcagtgcacagcttcctctggtccaagaaggagctgaggctgcagccctccagtaccaccaccatggccaagaacaccgtgtttctcatcgagatgctgctgcccaagaagtaccatgtgctgaggtttctggataaaggtgaaaggcatcctgtgcgggaagcccgtgccgtcatcttctttggtgaccaggagcatcccaatgtcaccgagtttgctgtggggcccctgccagggccctgctacatgcgagcactgtcccccaggcctgggtaccagtcctcctgggcatcgaggcccatctccacagcagagtatgccctcctctaccacaccctgcaggaagccaccaagcccctgcatcagttcttcctcaataccacaggcttctcattccaagactgccatgacagatgcctggccttcaccgatgtggccccccggggtgtggcttctggccagcgccgcagttggcttatcatacagcgctatgtagaaggctactttctgcaccccactgggctggagctcctcgtggatcatgggagcacagatgctgggcactgggccgtggagcaggtgtggtacaacgggaagttctatgggagcccagaggaactggctcggaagtatgcagatggagaggtggacgtggtggtcctggaggacccgctgcctgggggcaaggggcatgacagcacagaggagccgcccctcttctcctcccacaagccccgcggggacttccccagccccatccatgtgagcggcccccgcttggtccagccccacggccctcgcttcaggctggagggcaacgctgtgctctacggcggctggagctttgccttccggctgcgctcctcctccgggctgcaggtcctgaacgtgcacttcggcggagagcgcattgcctatgaggtcagcgtgcaagaggcagtggcgctgtatggaggacacacacctgcaggcatgcagaccaagtacctcgatgtcggctggggcctgggcagcgtcactcatgagttagcccccggcatcgactgcccggagaccgccaccttcctggacactttccactactatgatgccgatgacccggtccattatccccgagccctctgcctctttgaaatgcccacaggggtgccccttcggcggcactttaattccaactttaaaggtggcttcaacttctatgcagggctgaagggccaggtgctggtgctgcggacaacttcaactgtctacaattatgattacatttgggactttatcttctaccccaacggggtgatggaggccaagatgcatgccactggctacgtccacgccaccttctacacccccgaggggctgcgccacggcactcgcctgcacacccacctgattggcaacatacacactcacttggtgcactaccgcgtagacctggatgtggcaggcaccaagaacagcttccagacactgcagatgaagctagaaaacatcaccaacccctggagcccgagacaccgcgtggtccagccaactctggagcagacgcagtactcctgggagcgccaggcggccttccgcttcaaaaggaagctgcccaagtacctgctctttaccagcccccaggagaacccctggggccacaagcgcagctaccgcctgcagatccactccatggccgaccaggtgctgcccccaggctggcaggaggagcaggccatcacctgggcaaggtaccccctggcagtgaccaagtaccgggagtcagagctgtgcagcagcagcatctaccaccagaacgacccctgggacccgcccgtggtctttgagcagtttcttcacaacaacgagaacattgaaaatgaggacctggtggcctgggtgacggtgggcttcctgcacatcccccactcagaggacattcccaacacagccacacctgggaactccgtgggcttcctgctccggccattcaacttcttcccagaggacccctccctggcatccagagacactgtgatcgtgtggcctcgggacaacggccccaactacgtccagcgctggatccctgaggacagggactgctcgatgcctcccccttttagctacaatgggacctatagacctgtgtga
Sequence Length
2256
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
87,239 Da
NCBI Official Full Name
Homo sapiens amiloride binding protein 1 (amine oxidase (copper-containing)), mRNA
NCBI Official Synonym Full Names
amine oxidase, copper containing 1
NCBI Official Symbol
AOC1
NCBI Official Synonym Symbols
ABP; DAO; KAO; ABP1; DAO1
NCBI Protein Information
amiloride-sensitive amine oxidase [copper-containing]
UniProt Protein Name
Amiloride-sensitive amine oxidase [copper-containing]
Protein Family
UniProt Gene Name
AOC1
UniProt Synonym Gene Names
ABP1; DAO1; DAO; Diamine oxidase; KAO
UniProt Entry Name
AOC1_HUMAN
NCBI Description
This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Uniprot Description
ABP1: Catalyzes the degradation of compounds such as putrescine, histamine, spermine, and spermidine, substances involved in allergic and immune responses, cell proliferation, tissue differentiation, tumor formation, and possibly apoptosis. Placental DAO is thought to play a role in the regulation of the female reproductive function. Belongs to the copper/topaquinone oxidase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Oxidoreductase; Secreted; Amino Acid Metabolism - histidine; Amino Acid Metabolism - arginine and proline; EC 1.4.3.22; Secreted, signal peptide; Amino Acid Metabolism - tryptophan
Chromosomal Location of Human Ortholog: 7q36.1
Cellular Component: extracellular space; plasma membrane; tight junction
Molecular Function: amine oxidase activity; calcium ion binding; copper ion binding; drug binding; heparin binding; protein complex binding; protein homodimerization activity; quinone binding; receptor activity; zinc ion binding
Biological Process: response to antibiotic; response to drug; xenobiotic metabolic process
Research Articles on ABP1
Similar Products
Product Notes
The ABP1 aoc1 (Catalog #AAA1273282) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggccc tgggctgggc cgtggctgcc atcctgatgc tgcagacggc catggcggag ccctccccgg ggactctgcc caggaaggca ggggtgtttt cagacctaag caaccaagag ctgaaggcag tgcacagctt cctctggtcc aagaaggagc tgaggctgca gccctccagt accaccacca tggccaagaa caccgtgttt ctcatcgaga tgctgctgcc caagaagtac catgtgctga ggtttctgga taaaggtgaa aggcatcctg tgcgggaagc ccgtgccgtc atcttctttg gtgaccagga gcatcccaat gtcaccgagt ttgctgtggg gcccctgcca gggccctgct acatgcgagc actgtccccc aggcctgggt accagtcctc ctgggcatcg aggcccatct ccacagcaga gtatgccctc ctctaccaca ccctgcagga agccaccaag cccctgcatc agttcttcct caataccaca ggcttctcat tccaagactg ccatgacaga tgcctggcct tcaccgatgt ggccccccgg ggtgtggctt ctggccagcg ccgcagttgg cttatcatac agcgctatgt agaaggctac tttctgcacc ccactgggct ggagctcctc gtggatcatg ggagcacaga tgctgggcac tgggccgtgg agcaggtgtg gtacaacggg aagttctatg ggagcccaga ggaactggct cggaagtatg cagatggaga ggtggacgtg gtggtcctgg aggacccgct gcctgggggc aaggggcatg acagcacaga ggagccgccc ctcttctcct cccacaagcc ccgcggggac ttccccagcc ccatccatgt gagcggcccc cgcttggtcc agccccacgg ccctcgcttc aggctggagg gcaacgctgt gctctacggc ggctggagct ttgccttccg gctgcgctcc tcctccgggc tgcaggtcct gaacgtgcac ttcggcggag agcgcattgc ctatgaggtc agcgtgcaag aggcagtggc gctgtatgga ggacacacac ctgcaggcat gcagaccaag tacctcgatg tcggctgggg cctgggcagc gtcactcatg agttagcccc cggcatcgac tgcccggaga ccgccacctt cctggacact ttccactact atgatgccga tgacccggtc cattatcccc gagccctctg cctctttgaa atgcccacag gggtgcccct tcggcggcac tttaattcca actttaaagg tggcttcaac ttctatgcag ggctgaaggg ccaggtgctg gtgctgcgga caacttcaac tgtctacaat tatgattaca tttgggactt tatcttctac cccaacgggg tgatggaggc caagatgcat gccactggct acgtccacgc caccttctac acccccgagg ggctgcgcca cggcactcgc ctgcacaccc acctgattgg caacatacac actcacttgg tgcactaccg cgtagacctg gatgtggcag gcaccaagaa cagcttccag acactgcaga tgaagctaga aaacatcacc aacccctgga gcccgagaca ccgcgtggtc cagccaactc tggagcagac gcagtactcc tgggagcgcc aggcggcctt ccgcttcaaa aggaagctgc ccaagtacct gctctttacc agcccccagg agaacccctg gggccacaag cgcagctacc gcctgcagat ccactccatg gccgaccagg tgctgccccc aggctggcag gaggagcagg ccatcacctg ggcaaggtac cccctggcag tgaccaagta ccgggagtca gagctgtgca gcagcagcat ctaccaccag aacgacccct gggacccgcc cgtggtcttt gagcagtttc ttcacaacaa cgagaacatt gaaaatgagg acctggtggc ctgggtgacg gtgggcttcc tgcacatccc ccactcagag gacattccca acacagccac acctgggaac tccgtgggct tcctgctccg gccattcaac ttcttcccag aggacccctc cctggcatcc agagacactg tgatcgtgtg gcctcgggac aacggcccca actacgtcca gcgctggatc cctgaggaca gggactgctc gatgcctccc ccttttagct acaatgggac ctatagacct gtgtga. It is sometimes possible for the material contained within the vial of "ABP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
