Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABO cdna clone

ABO cDNA Clone

Gene Names
ABO; GTB; NAGAT; A3GALNT; A3GALT1
Synonyms
ABO; ABO cDNA Clone; ABO cdna clone
Ordering
For Research Use Only!
Sequence
atggccgaggtgttgcggacgctggccggaaaaccaaaatgccacgcacttcgacctatgatccttttcctaataatgcttgtcttggtcttgtttggttacggggtcctaagccccagaagtctaatgccaggaagcctggaacgggggttctgcatggctgttagggaacctgaccatctgcagcgcgtctcgttgccaaggatggtctacccccagccaaaggtgctgacaccgtgtaggaaggatgtcctcgtggtgaccccttggctggctcccattgtctgggagggcacgttcaacatcgacatcctcaacgagcagttcaggctccagaacaccaccattgggttaactgtgtttgccatcaagaaatacgtggctttcctgaagctgttcctggagacggcggagaagcacttcatggtgggccaccgtgtccactactatgtcttcaccgaccagccggccgcggtgccccgcgtgacgctggggaccggtcggcagctgtcagtgctggaggtgggcgcctacaagcgctggcaggacgtgtccatgcgccgcatggagatgatcagtgacttctgcgagcggcgcttcctcagcgaggtggattacctggtgtgcgtggacgtggacatggagttccgcgaccatgtgggcgtggagatcctgactccgctgttcggcaccctgcaccccagcttctacggaagcagccgggaggccttcacctacgagcgccggccccagtcccaggcctacatccccaaggacgagggcgatttctactacatgggggcgttcttcggggggtcggtgcaagaggtgcagcggctcaccagggcctgccaccaggccatgatggtcgaccaggccaacggcatcgaggccgtgtggcacgacgagagccacctgaacaagtacctactgcgccacaaacccaccaaggtgctctcccccgagtacttgtgggaccaacagctgctgggctggcccgccgtcctgaggaagctgaggttcactgcggtgcccaagaaccaccaggcggtccggaacccgtga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
28
Molecular Weight
40,934 Da
NCBI Official Full Name
Homo sapiens ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase), mRNA
NCBI Official Synonym Full Names
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
NCBI Official Symbol
ABO
NCBI Official Synonym Symbols
GTB; NAGAT; A3GALNT; A3GALT1
NCBI Protein Information
histo-blood group ABO system transferase
UniProt Protein Name
Histo-blood group ABO system transferase
UniProt Gene Name
ABO
UniProt Synonym Gene Names
A transferase; B transferase
UniProt Entry Name
BGAT_HUMAN

NCBI Description

This gene encodes proteins related to the first discovered blood group system, ABO. Which allele is present in an individual determines the blood group. The 'O' blood group is caused by a deletion of guanine-258 near the N-terminus of the protein which results in a frameshift and translation of an almost entirely different protein. Individuals with the A, B, and AB alleles express glycosyltransferase activities that convert the H antigen into the A or B antigen. Other minor alleles have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ABO: This protein is the basis of the ABO blood group system. The histo-blood group ABO involves three carbohydrate antigens: A, B, and H. A, B, and AB individuals express a glycosyltransferase activity that converts the H antigen to the A antigen (by addition of UDP-GalNAc) or to the B antigen (by addition of UDP-Gal), whereas O individuals lack such activity. Belongs to the glycosyltransferase 6 family.

Protein type: EC 2.4.1.37; Glycan Metabolism - glycosphingolipid biosynthesis - lacto and neolacto series; EC 2.4.1.40; Transferase; Membrane protein, integral

Chromosomal Location of Human Ortholog: 9q34.2

Disease: Blood Group, Abo System

Research Articles on ABO

Similar Products

Product Notes

The ABO abo (Catalog #AAA1275288) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagg tgttgcggac gctggccgga aaaccaaaat gccacgcact tcgacctatg atccttttcc taataatgct tgtcttggtc ttgtttggtt acggggtcct aagccccaga agtctaatgc caggaagcct ggaacggggg ttctgcatgg ctgttaggga acctgaccat ctgcagcgcg tctcgttgcc aaggatggtc tacccccagc caaaggtgct gacaccgtgt aggaaggatg tcctcgtggt gaccccttgg ctggctccca ttgtctggga gggcacgttc aacatcgaca tcctcaacga gcagttcagg ctccagaaca ccaccattgg gttaactgtg tttgccatca agaaatacgt ggctttcctg aagctgttcc tggagacggc ggagaagcac ttcatggtgg gccaccgtgt ccactactat gtcttcaccg accagccggc cgcggtgccc cgcgtgacgc tggggaccgg tcggcagctg tcagtgctgg aggtgggcgc ctacaagcgc tggcaggacg tgtccatgcg ccgcatggag atgatcagtg acttctgcga gcggcgcttc ctcagcgagg tggattacct ggtgtgcgtg gacgtggaca tggagttccg cgaccatgtg ggcgtggaga tcctgactcc gctgttcggc accctgcacc ccagcttcta cggaagcagc cgggaggcct tcacctacga gcgccggccc cagtcccagg cctacatccc caaggacgag ggcgatttct actacatggg ggcgttcttc ggggggtcgg tgcaagaggt gcagcggctc accagggcct gccaccaggc catgatggtc gaccaggcca acggcatcga ggccgtgtgg cacgacgaga gccacctgaa caagtaccta ctgcgccaca aacccaccaa ggtgctctcc cccgagtact tgtgggacca acagctgctg ggctggcccg ccgtcctgag gaagctgagg ttcactgcgg tgcccaagaa ccaccaggcg gtccggaacc cgtga. It is sometimes possible for the material contained within the vial of "ABO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.