Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABLIM1 cdna clone

ABLIM1 cDNA Clone

Gene Names
ABLIM1; ABLIM; LIMAB1; LIMATIN; abLIM-1
Synonyms
ABLIM1; ABLIM1 cDNA Clone; ABLIM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcacagaaggagaggaaatgtatcttcaaggctccaccgtttggcatcccgactgtaagcaatctacgaagaccgaggaaaagctgcgggcaaaagtagacaatgagatcctggattacaaggatttagcagccattccgaaggtcaaggcaatttatgacattgaacgtccagatcttattacctatgagcctttctacacttcgggctatgatgacaaacaggagagacagagccttggagagtctccgaggactttgtctcctactccatcagcagaagggtaccaggatgttcgggatcggatgatccatcggtccacgagccagggctccatcaactcccctgtgtacagccgccacagctacactccaaccacgtcccgctctccccagcatttccacagacctgatcaaggaatcaacatttaccgaaagccacccatctacaaacagcatgctgccttggcagcccagagcaagtcctcagaagatatcatcaagttttccaagttcccagcagcccaggcaccagaccccagcgagacaccaaagattgagacggaccactggcctggtcccccctcatttgctgtcgtaggacctgacatgaaacgcagatctagtggcagagaggaagatgatgaggaacttctgagacgtcggcagcttcaagaagagcaattaatgaagcttaactcaggcctgggacagttgatcttgaaagaagagatggagaaagagagccgggaaaggtcatctctgttagccagtcgctacgattctcccatcaactcagcttcacatattccatcatctaaaactgcatctctccctggctatggaagaaatgggcttcaccggcctgtttctaccgacttcgctcagtataacagctatggggatgtcagcgggggagtgcgagattaccagacactcccagatggccacatgcctgcaatgagaatggaccgaggagtgtctatgcccaacatgttggaaccaaagatatttccatatgaaatgctcatggtgaccaacagagggcgaaacaaaatcctcagagaggtggacagaaccaggctggagcgccacttagcccctgaagtgtttcgggaaatctttggaatgtccatacaggagtttgacaggttacctctttggagacgcaacgacatgaagaaaaaagcaaaactcttctaa
Sequence Length
1206
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,559 Da
NCBI Official Full Name
Homo sapiens actin binding LIM protein 1, mRNA
NCBI Official Synonym Full Names
actin binding LIM protein 1
NCBI Official Symbol
ABLIM1
NCBI Official Synonym Symbols
ABLIM; LIMAB1; LIMATIN; abLIM-1
NCBI Protein Information
actin-binding LIM protein 1
UniProt Protein Name
Actin-binding LIM protein 1
Protein Family
UniProt Gene Name
ABLIM1
UniProt Synonym Gene Names
ABLIM; KIAA0059; LIMAB1; abLIM-1
UniProt Entry Name
ABLM1_HUMAN

NCBI Description

This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

abLIM: a cytoskeletal LIM protein consisting of a C-terminal cytoskeletal domain fused to an N-terminal domain of four double zinc finger motifs. The C-terminal domain is 50% identical to dematin, an actin-bundling protein of the erythroid cytoskeleton. Undergoes extensive phosphorylation in light-adapted retinas in vivo and its developmental expression in the retina coincides with the elaboration of photoreceptor inner and outer segments. Three distinct splice variant isoforms have been described: ABLIM-l, ABLIM-m, ABLIM-s.

Protein type: Motility/polarity/chemotaxis; Cytoskeletal; Actin-binding

Chromosomal Location of Human Ortholog: 10q25

Cellular Component: actin cytoskeleton; lamellipodium; stress fiber

Molecular Function: protein binding

Biological Process: cilium biogenesis; lamellipodium biogenesis; organ morphogenesis; visual perception

Research Articles on ABLIM1

Similar Products

Product Notes

The ABLIM1 ablim1 (Catalog #AAA1271669) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcacag aaggagagga aatgtatctt caaggctcca ccgtttggca tcccgactgt aagcaatcta cgaagaccga ggaaaagctg cgggcaaaag tagacaatga gatcctggat tacaaggatt tagcagccat tccgaaggtc aaggcaattt atgacattga acgtccagat cttattacct atgagccttt ctacacttcg ggctatgatg acaaacagga gagacagagc cttggagagt ctccgaggac tttgtctcct actccatcag cagaagggta ccaggatgtt cgggatcgga tgatccatcg gtccacgagc cagggctcca tcaactcccc tgtgtacagc cgccacagct acactccaac cacgtcccgc tctccccagc atttccacag acctgatcaa ggaatcaaca tttaccgaaa gccacccatc tacaaacagc atgctgcctt ggcagcccag agcaagtcct cagaagatat catcaagttt tccaagttcc cagcagccca ggcaccagac cccagcgaga caccaaagat tgagacggac cactggcctg gtcccccctc atttgctgtc gtaggacctg acatgaaacg cagatctagt ggcagagagg aagatgatga ggaacttctg agacgtcggc agcttcaaga agagcaatta atgaagctta actcaggcct gggacagttg atcttgaaag aagagatgga gaaagagagc cgggaaaggt catctctgtt agccagtcgc tacgattctc ccatcaactc agcttcacat attccatcat ctaaaactgc atctctccct ggctatggaa gaaatgggct tcaccggcct gtttctaccg acttcgctca gtataacagc tatggggatg tcagcggggg agtgcgagat taccagacac tcccagatgg ccacatgcct gcaatgagaa tggaccgagg agtgtctatg cccaacatgt tggaaccaaa gatatttcca tatgaaatgc tcatggtgac caacagaggg cgaaacaaaa tcctcagaga ggtggacaga accaggctgg agcgccactt agcccctgaa gtgtttcggg aaatctttgg aatgtccata caggagtttg acaggttacc tctttggaga cgcaacgaca tgaagaaaaa agcaaaactc ttctaa. It is sometimes possible for the material contained within the vial of "ABLIM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.