Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABL1 cdna clone

ABL1 cDNA Clone

Gene Names
ABL1; ABL; JTK7; p150; c-ABL; v-abl; c-ABL1; bcr/abl
Synonyms
ABL1; ABL1 cDNA Clone; ABL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggggcagcagcctggaaaagtacttggggaccaaagaaggccaagcttgcctgccctgcattttatcaaaggagcagggaagaaggaatcatcgaggcatgggggtccacactgcaatgtttttgtggaacatgaagcccttcagcggccagtagcatctgactttgagcctcagggtctgagtgaagccgctcgttggaactccaaggaaaaccttctcgctggacccagtgaaaatgaccccaaccttttcgttgcactgtatgattttgtggccagtggagataacactctaagcataactaaaggtgaaaagctccgggtcttaggctataatcacaatggggaatggtgtgaagcccaaaccaaaaatggccaaggctgggtcccaagcaactacatcacgccagtcaacagtctggagaaacactcctggtaccatgggcctgtgtcccgcaatgccgctgagtatctgctgagcagcgggatcaatggcagcttcttggtgcgtgagagtgagagcagtcctggccagaggtccatctcgctgagatacgaagggagggtgtaccattacaggatcaacactgcttctgatggcaagctctacgtctcctccgagagccgcttcaacaccctggccgagttggttcatcatcattcaacggtggccgacgggctcatcaccacgctccattatccagccccaaagcgcaacaagcccactgtctatggtgtgtcccccaactacgacaagtgggagatggaacgcacggacatcaccatgaagcacaagctgggcgggggccagtacggggaggtgtacgagggcgtgtggaagaaatacagcctgacggtggccgtgaagaccttgaaggaggacaccatggaggtggaagagttcttgaaagaagctgcagtcatgaaagagatcaaacaccctaacctggtgcagctccttggggtctgcacccgggagcccccgttctatatcatcactgagttcatgacctacgggaacctcctggactacctgagggagtgcaaccggcaggaggtgaacgccgtggtgctgctgtacatggccactcagatctcgtcagccatggagtacctggagaagaaaaacttcatccacagagatcttgctgcccgaaactgcctggtaggggagaaccacttggtgaaggtagctgattttggcctgagcaggttgatgacaggggacacctacacagcccatgctggagccaagttccccatcaaatggactgcacccgagagcctggcctacaacaagttctccatcaagtccgacgtctgggcatttggagtattgctttgggaaattgctacctatggcatgtccccttacccgggaattgacctgtcccaggtgtatgagctgctagagaaggactaccgcatggagcgcccagaaggctgcccagagaaggtctatgaactcatgcgagcatgttggcagtggaatccctctgaccggccctcctttgctgaaatccaccaagcctttgaaacaatgttccaggaatccagtatctcagacgaagtggaaaaggagctggggaaacaaggcgtccgtggggctgtgagtaccttgctgcaggccccagagctgcccaccaagacgaggacctccaggagagctgcagagcacagagacaccactgacgtgcctgagatgcctcactccaagggccagggagagagcgatcctctggaccatgagcctgccgtgtctccattgctccctcgaaaagagcgaggtcccccggagggcggcctgaatgaagatgagcgccttctccccaaagacaaaaagaccaacttgttcagcgccttgatcaagaagaagaagaagacagccccaacccctcccaaacgcagcagctccttccgggagatggacggccagccggagcgcagaggggccggcgaggaagagggccgagacatcagcaacggggcactggctttcacccccttggacacagctgacccagccaagtccccaaagcccagcaatggggctggggtccccaatggagccctccgggagtccgggggctcaggcttccggtctccccacctgtggaagaagtccagcacgctgaccagcagccgcctagccaccggcgaggaggagggcggtggcagctccagcaagcgcttcctgcgctcttgctccgcctcctgcgttccccatggggccaaggacacggagtggaggtcagtcacgctgcctcgggacttgcagtccacgggaagacagtttgactcgtccacatttggagggcacaaaagtgagaagccggctctgcctcggaagagggcaggggagaacaggtctgaccaggtgacccgaggcacagtaacgcctccccccaggctggtgaaaaagaatgaggaagctgctgatgaggtcttcaaagacatcatggagtccagcccgggctccagcccgcccaacctgactccaaaacccctccggcggcaggtcaccgtggcccctgcctcgggcctcccccacaaggaagaagctggaaagggcagtgccttagggacccctgctgcagctgagccagtgacccccaccagcaaagcaggctcaggtgcaccagggggcaccagcaagggccccgccgaggagtccagagtgaggaggcacaagcactcctctgagtcgccagggagggacaaggggaaattgtccaggctcaaacctgccccgccgcccccaccagcagcctctgcagggaaggctggaggaaagccctcgcagagcccgagccaggaggcggccggggaggcagtcctgggcgcaaagacaaaagccacgagtctggttgatgctgtgaacagtgacgctgccaagcccagccagccgggagagggcctcaaaaagcccgtgctcccggccactccaaagccacagtccgccaagccgtcggggacccccatcagcccagcccccgttccctccacgttgccatcagcatcctcggccctggcaggggaccagccgtcttccaccgccttcatccctctcatatcaacccgagtgtctcttcggaaaacccgccagcctccagagcggatcgccagcggcgccatcaccaagggcgtggtcctggacagcaccgaggcgctgtgcctcgccatctctaggaactccgagcagatggccagccacagcgcagtgctggaggccggcaaaaacctctacacgttctgcgtgagctatgtggattccatccagcaaatgaggaacaagtttgccttccgagaggccatcaacaaactggagaataatctccgggagcttcagatctgcccggcgacagcaggcagtggtccggcggccactcaggacttcagcaagctcctcagttcggtgaaggaaatcagtgacatagtgcagaggtag
Sequence Length
3450
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
25
Molecular Weight
124,955 Da
NCBI Official Full Name
Homo sapiens c-abl oncogene 1, receptor tyrosine kinase, mRNA
NCBI Official Synonym Full Names
ABL proto-oncogene 1, non-receptor tyrosine kinase
NCBI Official Symbol
ABL1
NCBI Official Synonym Symbols
ABL; JTK7; p150; c-ABL; v-abl; c-ABL1; bcr/abl
NCBI Protein Information
tyrosine-protein kinase ABL1
UniProt Protein Name
Tyrosine-protein kinase ABL1
Protein Family
UniProt Gene Name
ABL1
UniProt Synonym Gene Names
ABL; JTK7
UniProt Entry Name
ABL1_HUMAN

NCBI Description

This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]

Uniprot Description

Abl: an ubiquitously expressed and highly conserved proto-oncogenic tyrosine kinase. c-Abl protein is distributed in both the nucleus and the cytoplasm of cells. Negatively regulated by its SH3 domain, and deletion of the SH3 domain turns ABL1 into an oncogene. It has been implicated in regulation of cell proliferation, differentiation, apoptosis, cell adhesion and stress response. The Philadephia chromosome translocation t(9;22)(q34;q11) creates a Bcr-Abl fusion protein, responsible for 90% of chronic myelogenous leukemia (CML) and ~25% of acute lymphoblastic leukemia (ALL). Inhibitors: Gleevec (imatinib, Glivec), Dasatinib. Two alternatively-spliced isoforms have been described.

Protein type: Abl family; EC 2.7.10.2; Kinase, protein; Oncoprotein; Protein kinase, TK; Protein kinase, tyrosine (non-receptor); TK group

Chromosomal Location of Human Ortholog: 9q34.1

Cellular Component: actin cytoskeleton; cytoplasm; cytosol; extrinsic to internal side of plasma membrane; nucleolus; nucleoplasm; nucleus; perinuclear region of cytoplasm

Molecular Function: actin monomer binding; ATP binding; magnesium ion binding; manganese ion binding; mitogen-activated protein kinase binding; nicotinate-nucleotide adenylyltransferase activity; non-membrane spanning protein tyrosine kinase activity; protein binding; protein C-terminus binding; protein kinase activity; protein kinase C binding; protein-tyrosine kinase activity; receptor binding; SH3 domain binding; syntaxin binding

Biological Process: actin cytoskeleton organization and biogenesis; cell cycle arrest; DNA damage induced protein phosphorylation; DNA damage response, signal transduction; DNA damage response, signal transduction resulting in induction of apoptosis; elevation of cytosolic calcium ion concentration; establishment of protein localization; innate immune response; mismatch repair; mitochondrial depolarization; mitosis; negative regulation of ubiquitin-protein ligase activity; peptidyl-tyrosine phosphorylation; positive regulation of apoptosis; positive regulation of muscle cell differentiation; positive regulation of oxidoreductase activity; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of protein amino acid phosphorylation; protein amino acid autophosphorylation; regulation of actin cytoskeleton organization and biogenesis; regulation of autophagy; regulation of axon extension; regulation of cell adhesion; regulation of cell proliferation; regulation of endocytosis; regulation of microtubule polymerization; regulation of transcription, DNA-dependent; response to DNA damage stimulus; response to oxidative stress

Disease: Leukemia, Chronic Myeloid

Research Articles on ABL1

Similar Products

Product Notes

The ABL1 abl1 (Catalog #AAA1267867) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcagc agcctggaaa agtacttggg gaccaaagaa ggccaagctt gcctgccctg cattttatca aaggagcagg gaagaaggaa tcatcgaggc atgggggtcc acactgcaat gtttttgtgg aacatgaagc ccttcagcgg ccagtagcat ctgactttga gcctcagggt ctgagtgaag ccgctcgttg gaactccaag gaaaaccttc tcgctggacc cagtgaaaat gaccccaacc ttttcgttgc actgtatgat tttgtggcca gtggagataa cactctaagc ataactaaag gtgaaaagct ccgggtctta ggctataatc acaatgggga atggtgtgaa gcccaaacca aaaatggcca aggctgggtc ccaagcaact acatcacgcc agtcaacagt ctggagaaac actcctggta ccatgggcct gtgtcccgca atgccgctga gtatctgctg agcagcggga tcaatggcag cttcttggtg cgtgagagtg agagcagtcc tggccagagg tccatctcgc tgagatacga agggagggtg taccattaca ggatcaacac tgcttctgat ggcaagctct acgtctcctc cgagagccgc ttcaacaccc tggccgagtt ggttcatcat cattcaacgg tggccgacgg gctcatcacc acgctccatt atccagcccc aaagcgcaac aagcccactg tctatggtgt gtcccccaac tacgacaagt gggagatgga acgcacggac atcaccatga agcacaagct gggcgggggc cagtacgggg aggtgtacga gggcgtgtgg aagaaataca gcctgacggt ggccgtgaag accttgaagg aggacaccat ggaggtggaa gagttcttga aagaagctgc agtcatgaaa gagatcaaac accctaacct ggtgcagctc cttggggtct gcacccggga gcccccgttc tatatcatca ctgagttcat gacctacggg aacctcctgg actacctgag ggagtgcaac cggcaggagg tgaacgccgt ggtgctgctg tacatggcca ctcagatctc gtcagccatg gagtacctgg agaagaaaaa cttcatccac agagatcttg ctgcccgaaa ctgcctggta ggggagaacc acttggtgaa ggtagctgat tttggcctga gcaggttgat gacaggggac acctacacag cccatgctgg agccaagttc cccatcaaat ggactgcacc cgagagcctg gcctacaaca agttctccat caagtccgac gtctgggcat ttggagtatt gctttgggaa attgctacct atggcatgtc cccttacccg ggaattgacc tgtcccaggt gtatgagctg ctagagaagg actaccgcat ggagcgccca gaaggctgcc cagagaaggt ctatgaactc atgcgagcat gttggcagtg gaatccctct gaccggccct cctttgctga aatccaccaa gcctttgaaa caatgttcca ggaatccagt atctcagacg aagtggaaaa ggagctgggg aaacaaggcg tccgtggggc tgtgagtacc ttgctgcagg ccccagagct gcccaccaag acgaggacct ccaggagagc tgcagagcac agagacacca ctgacgtgcc tgagatgcct cactccaagg gccagggaga gagcgatcct ctggaccatg agcctgccgt gtctccattg ctccctcgaa aagagcgagg tcccccggag ggcggcctga atgaagatga gcgccttctc cccaaagaca aaaagaccaa cttgttcagc gccttgatca agaagaagaa gaagacagcc ccaacccctc ccaaacgcag cagctccttc cgggagatgg acggccagcc ggagcgcaga ggggccggcg aggaagaggg ccgagacatc agcaacgggg cactggcttt cacccccttg gacacagctg acccagccaa gtccccaaag cccagcaatg gggctggggt ccccaatgga gccctccggg agtccggggg ctcaggcttc cggtctcccc acctgtggaa gaagtccagc acgctgacca gcagccgcct agccaccggc gaggaggagg gcggtggcag ctccagcaag cgcttcctgc gctcttgctc cgcctcctgc gttccccatg gggccaagga cacggagtgg aggtcagtca cgctgcctcg ggacttgcag tccacgggaa gacagtttga ctcgtccaca tttggagggc acaaaagtga gaagccggct ctgcctcgga agagggcagg ggagaacagg tctgaccagg tgacccgagg cacagtaacg cctcccccca ggctggtgaa aaagaatgag gaagctgctg atgaggtctt caaagacatc atggagtcca gcccgggctc cagcccgccc aacctgactc caaaacccct ccggcggcag gtcaccgtgg cccctgcctc gggcctcccc cacaaggaag aagctggaaa gggcagtgcc ttagggaccc ctgctgcagc tgagccagtg acccccacca gcaaagcagg ctcaggtgca ccagggggca ccagcaaggg ccccgccgag gagtccagag tgaggaggca caagcactcc tctgagtcgc cagggaggga caaggggaaa ttgtccaggc tcaaacctgc cccgccgccc ccaccagcag cctctgcagg gaaggctgga ggaaagccct cgcagagccc gagccaggag gcggccgggg aggcagtcct gggcgcaaag acaaaagcca cgagtctggt tgatgctgtg aacagtgacg ctgccaagcc cagccagccg ggagagggcc tcaaaaagcc cgtgctcccg gccactccaa agccacagtc cgccaagccg tcggggaccc ccatcagccc agcccccgtt ccctccacgt tgccatcagc atcctcggcc ctggcagggg accagccgtc ttccaccgcc ttcatccctc tcatatcaac ccgagtgtct cttcggaaaa cccgccagcc tccagagcgg atcgccagcg gcgccatcac caagggcgtg gtcctggaca gcaccgaggc gctgtgcctc gccatctcta ggaactccga gcagatggcc agccacagcg cagtgctgga ggccggcaaa aacctctaca cgttctgcgt gagctatgtg gattccatcc agcaaatgag gaacaagttt gccttccgag aggccatcaa caaactggag aataatctcc gggagcttca gatctgcccg gcgacagcag gcagtggtcc ggcggccact caggacttca gcaagctcct cagttcggtg aaggaaatca gtgacatagt gcagaggtag. It is sometimes possible for the material contained within the vial of "ABL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.