Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABHD5 cdna clone

ABHD5 cDNA Clone

Gene Names
ABHD5; CDS; CGI58; IECN2; NCIE2
Synonyms
ABHD5; ABHD5 cDNA Clone; ABHD5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggaggaggaggaggtggactctgccgacaccggagagaggtcaggatggctaactggttggctccccacatggtgccctacgtctatatcacaccttaaagaagctgaagagaagatgttaaaatgtgtgccttgcacatacaaaaaagaacctgttcgtatatctaatggaaataaaatatggacactgaagttctctcataatatttcaaataagactccacttgtccttctccatggttttggaggaggtcttgggctctgggcactgaattttggagatctttgcaccaacagacctgtctatgcttttgacctattgggttttggacgaagtagtagacccaggtttgacagtgatgcagaagaagtggagaatcagtttgtggaatccattgaagagtggagatgtgccctaggattggacaaaatgatcttgcttgggcacaacctaggtggattcttggctgctgcttactcgctgaagtacccatcaagggttaatcatctcattttagtggagccttggggtttccctgaacgaccagaccttgctgatcaagacagaccaattccagtttggatcagagccttgggagcagcattgactccctttaaccctttagctggcctaaggattgcaggaccctttggtttaagtctagtgcagcgtttaaggcctgatttcaaacgaaagtattcttcaatgttcgaagacgatactgtgacagaatacatctaccactgtaatgtgcagactccaagtggtgagacagctttcaagaatatgactattccttatggatgggcaaaaaggccaatgctccagcgaattggtaaaatgcaccctgacattccagtttcagtgatctttggcgcccgatcctgcatagatggcaattctggcaccagcatccagtccttacgaccacattcatatgtgaagacaatagctattcttggggcaggacattatgtatatgcagatcaaccagaagaattcaaccagaaagtaaaggagatctgcgacactgtggactga
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,096 Da
NCBI Official Full Name
Homo sapiens abhydrolase domain containing 5, mRNA
NCBI Official Synonym Full Names
abhydrolase domain containing 5
NCBI Official Symbol
ABHD5
NCBI Official Synonym Symbols
CDS; CGI58; IECN2; NCIE2
NCBI Protein Information
1-acylglycerol-3-phosphate O-acyltransferase ABHD5
UniProt Protein Name
1-acylglycerol-3-phosphate O-acyltransferase ABHD5
UniProt Gene Name
ABHD5
UniProt Synonym Gene Names
NCIE2
UniProt Entry Name
ABHD5_HUMAN

NCBI Description

The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq, Jul 2008]

Uniprot Description

ABHD5: a lysophosphatidic acid acyltransferase which functions in phosphatidic acid biosynthesis. May regulate the cellular storage of triacylglycerol through activation of the phospholipase PNPLA2. Involved in keratinocyte differentiation. Colocalized with PLIN and ADFP on the surface of lipid droplets. The localization is dependent upon the metabolic status of the adipocytes and the activity of PKA. Defects cause neutral lipid storage disease (NLSD), an autosomal recessive disorder characterized by the excessive accumulation of neutral lipids in multiple tissues, and Chanarin-Dorfman syndrome (CDS), a triglyceride storage disease with impaired long-chain fatty acid oxidation and icthyosis. CDS is an autosomal recessive inborn error of lipid metabolism with multisystemic accumulation of triglycerides although plasma concentrations are normal. Widely expressed in various tissues, including lymphocytes, liver, skeletal muscle and brain. Expressed by upper epidermal layers and dermal fibroblasts in skin, hepatocytes and neurons.

Protein type: Transferase; Lipase; EC 2.3.1.51

Chromosomal Location of Human Ortholog: 3p21

Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle; lipid particle; nucleus

Molecular Function: lysophosphatidic acid acyltransferase activity; triacylglycerol lipase activity

Biological Process: phosphatidic acid biosynthetic process

Disease: Chanarin-dorfman Syndrome

Research Articles on ABHD5

Similar Products

Product Notes

The ABHD5 abhd5 (Catalog #AAA1270838) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg aggaggagga ggtggactct gccgacaccg gagagaggtc aggatggcta actggttggc tccccacatg gtgccctacg tctatatcac accttaaaga agctgaagag aagatgttaa aatgtgtgcc ttgcacatac aaaaaagaac ctgttcgtat atctaatgga aataaaatat ggacactgaa gttctctcat aatatttcaa ataagactcc acttgtcctt ctccatggtt ttggaggagg tcttgggctc tgggcactga attttggaga tctttgcacc aacagacctg tctatgcttt tgacctattg ggttttggac gaagtagtag acccaggttt gacagtgatg cagaagaagt ggagaatcag tttgtggaat ccattgaaga gtggagatgt gccctaggat tggacaaaat gatcttgctt gggcacaacc taggtggatt cttggctgct gcttactcgc tgaagtaccc atcaagggtt aatcatctca ttttagtgga gccttggggt ttccctgaac gaccagacct tgctgatcaa gacagaccaa ttccagtttg gatcagagcc ttgggagcag cattgactcc ctttaaccct ttagctggcc taaggattgc aggacccttt ggtttaagtc tagtgcagcg tttaaggcct gatttcaaac gaaagtattc ttcaatgttc gaagacgata ctgtgacaga atacatctac cactgtaatg tgcagactcc aagtggtgag acagctttca agaatatgac tattccttat ggatgggcaa aaaggccaat gctccagcga attggtaaaa tgcaccctga cattccagtt tcagtgatct ttggcgcccg atcctgcata gatggcaatt ctggcaccag catccagtcc ttacgaccac attcatatgt gaagacaata gctattcttg gggcaggaca ttatgtatat gcagatcaac cagaagaatt caaccagaaa gtaaaggaga tctgcgacac tgtggactga. It is sometimes possible for the material contained within the vial of "ABHD5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.