Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AASDHPPT cdna clone

AASDHPPT cDNA Clone

Gene Names
AASDHPPT; LYS2; LYS5; CGI-80; AASD-PPT
Synonyms
AASDHPPT; AASDHPPT cDNA Clone; AASDHPPT cdna clone
Ordering
For Research Use Only!
Sequence
atggttttccctgccaaacggttctgcttggtgccatccatggagggcgtgcgctgggccttttcctgcggcacttggctgccgagccgagccgaatggctgctggcagtgcgatcgattcagcccgaggagaaggagcgcattggccagttcgtctttgcccgggacgctaaggcagccatggctggtcgtctgatgataaggaaattagttgcagagaaattgaatatcccttggaatcatattcgtttgcaaagaactgcaaaaggaaaaccagttcttgcaaaggactcatcgaatccttacccgaatttcaactttaacatctctcatcaaggagactatgcagtgcttgctgctgaacctgagctgcaagttggaattgatataatgaagactagttttccaggtcgtggttcaattccagaattctttcatattatgaaaagaaagtttaccaacaaagaatgggaaacaatcagaagctttaaggatgagtggactcagctggatatgttttataggaattgggcacttaaggaaagcttcataaaagccattggtgttggactaggatttgaattgcagcggcttgaatttgatctatctccattaaacttggatataggccaagtttataaagaaacacgtttattcctggatggagaggaagaaaaagaatgggcatttgaggaaagcaaaatagatgagcaccattttgttgcagttgctcttaggaaacccgatggatctagacatcaggatgttccatctcaggatgattccaaaccaacccagaggcaatttactattctcaactttaatgatttaatgtcatctgccgttcccatgacacctgaagatccttcattttgggactgtttttgcttcacagaagaaattccaatacgaaatggtacaaagtcatga
Sequence Length
930
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
35,776 Da
NCBI Official Full Name
Homo sapiens aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase, mRNA
NCBI Official Synonym Full Names
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
NCBI Official Symbol
AASDHPPT
NCBI Official Synonym Symbols
LYS2; LYS5; CGI-80; AASD-PPT
NCBI Protein Information
L-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase; LYS5 ortholog; 4'-phosphopantetheinyl transferase; alpha-aminoadipic semialdehyde dehydrogenase-phosphopantetheinyl transferase
UniProt Protein Name
L-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
UniProt Gene Name
AASDHPPT
UniProt Synonym Gene Names
AASD-PPT
UniProt Entry Name
ADPPT_HUMAN

NCBI Description

The protein encoded by this gene is similar to Saccharomyces cerevisiae LYS5, which is required for the activation of the alpha-aminoadipate dehydrogenase in the biosynthetic pathway of lysine. Yeast alpha-aminoadipate dehydrogenase converts alpha-biosynthetic-aminoadipate semialdehyde to alpha-aminoadipate. It has been suggested that defects in the human gene result in pipecolic acidemia. [provided by RefSeq, Jul 2008]

Uniprot Description

AASDHPPT: Catalyzes the post-translational modification of target proteins by phosphopantetheine. Can transfer the 4'- phosphopantetheine moiety from coenzyme A to a serine residue of a broad range of acceptors, such as the acyl carrier domain of FASN. Belongs to the P-Pant transferase superfamily. AcpS family.

Protein type: EC 2.7.8.-; Amino Acid Metabolism - lysine degradation; Transferase; Amino Acid Metabolism - lysine biosynthesis

Chromosomal Location of Human Ortholog: 11q22

Cellular Component: cytosol

Molecular Function: protein binding; phosphopantetheinyltransferase activity; magnesium ion binding

Biological Process: vitamin metabolic process; macromolecule biosynthetic process; pantothenate metabolic process; water-soluble vitamin metabolic process

Research Articles on AASDHPPT

Similar Products

Product Notes

The AASDHPPT aasdhppt (Catalog #AAA1268876) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttttcc ctgccaaacg gttctgcttg gtgccatcca tggagggcgt gcgctgggcc ttttcctgcg gcacttggct gccgagccga gccgaatggc tgctggcagt gcgatcgatt cagcccgagg agaaggagcg cattggccag ttcgtctttg cccgggacgc taaggcagcc atggctggtc gtctgatgat aaggaaatta gttgcagaga aattgaatat cccttggaat catattcgtt tgcaaagaac tgcaaaagga aaaccagttc ttgcaaagga ctcatcgaat ccttacccga atttcaactt taacatctct catcaaggag actatgcagt gcttgctgct gaacctgagc tgcaagttgg aattgatata atgaagacta gttttccagg tcgtggttca attccagaat tctttcatat tatgaaaaga aagtttacca acaaagaatg ggaaacaatc agaagcttta aggatgagtg gactcagctg gatatgtttt ataggaattg ggcacttaag gaaagcttca taaaagccat tggtgttgga ctaggatttg aattgcagcg gcttgaattt gatctatctc cattaaactt ggatataggc caagtttata aagaaacacg tttattcctg gatggagagg aagaaaaaga atgggcattt gaggaaagca aaatagatga gcaccatttt gttgcagttg ctcttaggaa acccgatgga tctagacatc aggatgttcc atctcaggat gattccaaac caacccagag gcaatttact attctcaact ttaatgattt aatgtcatct gccgttccca tgacacctga agatccttca ttttgggact gtttttgctt cacagaagaa attccaatac gaaatggtac aaagtcatga. It is sometimes possible for the material contained within the vial of "AASDHPPT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.