Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AARSD1 cdna clone

AARSD1 cDNA Clone

Synonyms
AARSD1; AARSD1 cDNA Clone; AARSD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagttttgtgttgaggacagcaccgatgtccacgtgcttattgaggatcaccgcattgtgttcagctgcaagaatgccgatggagtggagttgtacaatgagattgagttctatgccaaagtgaactccaaggactcccaggataagcgctcttcccgctctattacttgttttgtgagaaaatggaaggaaaaggtggcctggccgcggcttaccaaggaggatatcaagccagtgtggctgtctgtggactttgataactggagagactgggaaggggatgaagagatggagctggctcatgtggaacattatgcagagcttttgaagaaggtcagcaccaagagacctccacctgccatggatgatttggatttcaccaccaccgtggtctcttgctgtcccgcggagctgcagactgaagggagcaacggcaagaaagaagtgctgagcggtttccaagtggtgctggaagacacagtgcttttccctgagggcgggggacagcctgatgaccgtggtacaatcaatgacatctctgtgctgagagtgactcgccgtggggaacaggctgatcatttcacccagacacccctggatccaggaagccaggttctggtccgggtagattgggagcggaggtttgaccacatgcagcagcattcagggcagcatctcatcacggcagttgctgaccatctatttaagctgaagacaacatcatgggagttagggagatttcggagtgcgattgagctggacaccccctctatgactgcagagcaagtagctgccattgagcagagcgtcaatgaaaaaatcagagatcggctgcctgtgaatgtccgagaactgagcctggatgatcctgaggtggagcaggtgagtggccggggtttgcctgatgatcatgctgggcccattcgggttgttaacatcgagggcgttgattccaacatgtgctgtgggacccatgtgagcaatctcagtgaccttcaggtcattaagattctgggcactgagaaggggaaaaagaacagaaccaacctgatatttctgtctgggaaccgggtgctgaagtggatggagagaagtcatggaactgaaaaagcactgactgctctgcttaagtgtggagcagaggatcatgtggaagcagtgaaaaagctccagaactccaccaagatcctgcagaagaataacctgaatctgctcagagacctggctgtgcacattgcccatagcctcaggaacagtccagactggggaggtgtggtcatattacacaggaaggagggtgattcagagttcatgaatatcattgccaatgagattgggtcagaggagaccctcctgttcttaactgtgggcgatgagaaaggtggtggactcttcttactggcagggccacctgcgtctgtggagaccctggggcccagggtggctgaggtcctggaaggcaaaggagcagggaagaaaggccgttttcagggcaaggccaccaagatgagccggcggatggaggcgcaggcgcttctccaggactacatcagcacgcagagtgctaaggagtga
Sequence Length
1578
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,702 Da
NCBI Official Full Name
Homo sapiens alanyl-tRNA synthetase domain containing 1, mRNA
NCBI Official Synonym Full Names
alanyl-tRNA synthetase domain containing 1
NCBI Official Symbol
AARSD1
NCBI Protein Information
alanyl-tRNA editing protein Aarsd1
UniProt Protein Name
Alanyl-tRNA editing protein Aarsd1
UniProt Gene Name
AARSD1
UniProt Entry Name
AASD1_HUMAN

Uniprot Description

AARSD1: Functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). Belongs to the class-II aminoacyl-tRNA synthetase family. Alax-L subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase

Chromosomal Location of Human Ortholog: 17q21.31

Cellular Component: nucleus

Molecular Function: tRNA binding

Biological Process: regulation of translational fidelity

Similar Products

Product Notes

The AARSD1 aarsd1 (Catalog #AAA1267488) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtttt gtgttgagga cagcaccgat gtccacgtgc ttattgagga tcaccgcatt gtgttcagct gcaagaatgc cgatggagtg gagttgtaca atgagattga gttctatgcc aaagtgaact ccaaggactc ccaggataag cgctcttccc gctctattac ttgttttgtg agaaaatgga aggaaaaggt ggcctggccg cggcttacca aggaggatat caagccagtg tggctgtctg tggactttga taactggaga gactgggaag gggatgaaga gatggagctg gctcatgtgg aacattatgc agagcttttg aagaaggtca gcaccaagag acctccacct gccatggatg atttggattt caccaccacc gtggtctctt gctgtcccgc ggagctgcag actgaaggga gcaacggcaa gaaagaagtg ctgagcggtt tccaagtggt gctggaagac acagtgcttt tccctgaggg cgggggacag cctgatgacc gtggtacaat caatgacatc tctgtgctga gagtgactcg ccgtggggaa caggctgatc atttcaccca gacacccctg gatccaggaa gccaggttct ggtccgggta gattgggagc ggaggtttga ccacatgcag cagcattcag ggcagcatct catcacggca gttgctgacc atctatttaa gctgaagaca acatcatggg agttagggag atttcggagt gcgattgagc tggacacccc ctctatgact gcagagcaag tagctgccat tgagcagagc gtcaatgaaa aaatcagaga tcggctgcct gtgaatgtcc gagaactgag cctggatgat cctgaggtgg agcaggtgag tggccggggt ttgcctgatg atcatgctgg gcccattcgg gttgttaaca tcgagggcgt tgattccaac atgtgctgtg ggacccatgt gagcaatctc agtgaccttc aggtcattaa gattctgggc actgagaagg ggaaaaagaa cagaaccaac ctgatatttc tgtctgggaa ccgggtgctg aagtggatgg agagaagtca tggaactgaa aaagcactga ctgctctgct taagtgtgga gcagaggatc atgtggaagc agtgaaaaag ctccagaact ccaccaagat cctgcagaag aataacctga atctgctcag agacctggct gtgcacattg cccatagcct caggaacagt ccagactggg gaggtgtggt catattacac aggaaggagg gtgattcaga gttcatgaat atcattgcca atgagattgg gtcagaggag accctcctgt tcttaactgt gggcgatgag aaaggtggtg gactcttctt actggcaggg ccacctgcgt ctgtggagac cctggggccc agggtggctg aggtcctgga aggcaaagga gcagggaaga aaggccgttt tcagggcaag gccaccaaga tgagccggcg gatggaggcg caggcgcttc tccaggacta catcagcacg cagagtgcta aggagtga. It is sometimes possible for the material contained within the vial of "AARSD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.