Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LATS1 cdna clone

LATS1 cDNA Clone

Gene Names
LATS1; wts; WARTS
Synonyms
LATS1; LATS1 cDNA Clone; LATS1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaggagtgaaaagccagaaggatatagacaaatgaggcctaagacctttcctgccagtaactatactgtcagtagccggcaaatgttacaagaaattcgggaatcccttaggaatttatctaaaccatctgatgctgctaaggctgagcataacatgagtaaaatgtcaaccgaagatcctcgacaagtcagaaatccacccaaatttgggacgcatcataaagccttgcaggaaattcgaaactctctgcttccatttgcaaatgaaacaaattcttctcggagtacttcagaagttaatccacaaatgcttcaagacttgcaagctgctggatttgatgaggaggatcatctgtcagtagcctgttcacccattagtcttactaagccatttctcatttaa
Sequence Length
408
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,193 Da
NCBI Official Full Name
Homo sapiens LATS, large tumor suppressor, homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
large tumor suppressor kinase 1
NCBI Official Symbol
LATS1
NCBI Official Synonym Symbols
wts; WARTS
NCBI Protein Information
serine/threonine-protein kinase LATS1
UniProt Protein Name
Serine/threonine-protein kinase LATS1
UniProt Gene Name
LATS1
UniProt Synonym Gene Names
h-warts
UniProt Entry Name
LATS1_HUMAN

NCBI Description

The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

LATS1: an AGC kinase of the NDR family of kinases. Localized to the mitotic apparatus and specifically phosphorylated during mitosis. A likely tumor suppressor which plays a critical role in maintenance of ploidy through its actions in both mitotic progression and the G1 tetraploidy checkpoint. Negatively regulates G2/M transition by down-regulating CDC2 kinase activity, causing G2 arrest. Involved in the control of p53 expression. Affects cytokinesis by regulating actin polymerization through negative modulation of LIMK1. Complexes with CDC2 in early mitosis. LATS1-associated CDC2 has no mitotic cyclin partner and no apparent kinase activity. Binds phosphorylated zyxin, locating this protein to the mitotic spindle and suggesting a role for actin regulatory proteins during mitosis. Binds to and colocalizes with LIMK1 at the actomyosin contractile ring during cytokinesis. Knockout mice are susceptible to soft-tissue sarcomas and sensitive to chemical carcinogenesis. Human soft tissue sarcomas have downregulated, mutated, and/or hypermethylated LATS1. Transgenic expression blocks anchorage independent growth in culture and tumor growth in xenografts. Two alternatively spliced isoforms of the human proteinhave been described.

Protein type: Kinase, protein; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; Tumor suppressor; Protein kinase, AGC; AGC group; NDR family

Chromosomal Location of Human Ortholog: 6q25.1

Cellular Component: cytosol; spindle pole

Molecular Function: ATP binding; magnesium ion binding; protein binding; protein kinase binding; protein serine/threonine kinase activity

Biological Process: cytoplasmic sequestering of protein; G1/S transition of mitotic cell cycle; G2/M transition of mitotic cell cycle; hormone-mediated signaling; negative regulation of cyclin-dependent protein kinase activity; positive regulation of apoptosis; positive regulation of peptidyl-serine phosphorylation; protein amino acid phosphorylation; regulation of actin filament polymerization; regulation of organ growth; regulation of protein complex assembly; sister chromatid segregation

Research Articles on LATS1

Similar Products

Product Notes

The LATS1 lats1 (Catalog #AAA7046740) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagagga gtgaaaagcc agaaggatat agacaaatga ggcctaagac ctttcctgcc agtaactata ctgtcagtag ccggcaaatg ttacaagaaa ttcgggaatc ccttaggaat ttatctaaac catctgatgc tgctaaggct gagcataaca tgagtaaaat gtcaaccgaa gatcctcgac aagtcagaaa tccacccaaa tttgggacgc atcataaagc cttgcaggaa attcgaaact ctctgcttcc atttgcaaat gaaacaaatt cttctcggag tacttcagaa gttaatccac aaatgcttca agacttgcaa gctgctggat ttgatgagga ggatcatctg tcagtagcct gttcacccat tagtcttact aagccatttc tcatttaa. It is sometimes possible for the material contained within the vial of "LATS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.