Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MED21 cdna clone

MED21

Gene Names
MED21; SRB7; SURB7; hSrb7
Synonyms
MED21; hSrb7; SRB7; SURB7; MED21 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGGCGGATCGGCTCACGCAGCTTCAGGACGCTGTGAATTCGCTTGCAGATCAGTTTTGTAATGCCATTGGAGTATTGCAGCAATGTGGTCCTCCTGCCTCTTTCAATAATATTCAGACAGCAATTAACAAAGACCAGCCAGCTAACCCTACAGAAGAGTATGCCCAGCTTTTTGCAGCACTGATTGCACGAACAGCAAAAGACATTGATGTTTTGATAGATTCCTTACCCAGTGAAGAATCTACAGCTGCTTTACAGGCTGCTAGCTTGTATAAGCTAGAAGAAGAAAACCATGAAGCTGCTACATGTCTGGAGGATGTTGTTTATCGAGGAGACATGCTTCTGGAGAAGATACAAAGCGCACTTGCTGATATTGCACAGTCACAGCTGAAGACAAGAAGTGGTACCCATAGCCAGTCTCTTCCAGACTCATAG

Translation Sequence: MADRLTQLQD AVNSLADQFC NAIGVLQQCG PPASFNNIQT AINKDQPANP TEEYAQLFAALIARTAKDID VLIDSLPSEE STAALQAASL YKLEEENHEA ATCLEDVVYR GDMLLEKIQSALADIAQSQL KTRSGTHSQS LPDS
Sequence Length
144
Species
Human
Chromosome Location
12p11.23
OMIM Reference Number
603800
cDNA Size
435bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for MED21 cdna clone
MED21 is a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants.
Product Categories/Family for MED21 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
mediator of RNA polymerase II transcription subunit 21 isoform 1
NCBI Official Synonym Full Names
mediator complex subunit 21
NCBI Official Symbol
MED21
NCBI Official Synonym Symbols
SRB7; SURB7; hSrb7
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 21
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 21
UniProt Gene Name
MED21
UniProt Synonym Gene Names
SRB7; SURB7; RNAPII complex component SRB7; hSrb7
UniProt Entry Name
MED21_HUMAN

NCBI Description

This gene encodes a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Uniprot Description

MED21: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Belongs to the Mediator complex subunit 21 family.

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 12p11.23

Cellular Component: Srb-mediator complex

Molecular Function: protein binding; DNA-directed RNA polymerase activity; transcription coactivator activity

Biological Process: regulation of transcription from RNA polymerase II promoter; blastocyst development; transcription, DNA-dependent; stem cell maintenance; positive regulation of transcription from RNA polymerase II promoter

Research Articles on MED21

Similar Products

Product Notes

The MED21 med21 (Catalog #AAA200991) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGGCGGATC GGCTCACGCA GCTTCAGGAC GCTGTGAATT CGCTTGCAGA TCAGTTTTGT AATGCCATTG GAGTATTGCA GCAATGTGGT CCTCCTGCCT CTTTCAATAA TATTCAGACA GCAATTAACA AAGACCAGCC AGCTAACCCT ACAGAAGAGT ATGCCCAGCT TTTTGCAGCA CTGATTGCAC GAACAGCAAA AGACATTGAT GTTTTGATAG ATTCCTTACC CAGTGAAGAA TCTACAGCTG CTTTACAGGC TGCTAGCTTG TATAAGCTAG AAGAAGAAAA CCATGAAGCT GCTACATGTC TGGAGGATGT TGTTTATCGA GGAGACATGC TTCTGGAGAA GATACAAAGC GCACTTGCTG ATATTGCACA GTCACAGCTG AAGACAAGAA GTGGTACCCA TAGCCAGTCT CTTCCAGACT CATAG < br>Transla tion Sequence: MADRLTQLQD AVNSLADQFC NAIGVLQQCG PPASFNNIQT AINKDQPANP TEEYAQLFAA LIARTAKDID VLIDSLPSEE STAALQAASL YKLEEENHEA ATCLEDVVYR GDMLLEKIQS ALADIAQSQL KTRSGTHSQS LPDS. It is sometimes possible for the material contained within the vial of "MED21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.