NKX3-1 cdna clone

NKX3-1

Cat. Num. AAA200835

• Gene Names: NKX3-1; NKX3; BAPX2; NKX3A; NKX3.1
• Synonyms: NKX3-1; BAPX2; NKX3; NKX3.1; NKX3A; NKX3-1 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGCTCAGGGTTCCGGAGCCGCGGCCCGGGGAGGCGAAAGCGGAGGGGGCCGCGCCGCCGACCCCGTCCAAGCCGCTCACGTCCTTCCTCATCCAGGACATCCTGCGGGACGGCGCGCAGCGGCAAGGCGGCCGCACGAGCAGCCAGAGACAGCGCGACCCGGAGCCGGAGCCAGAGCCAGAGCCAGAGGGAGGACGCAGCCGCGCCGGGGCGCAGAACGACCAGCTGAGCACCGGGCCCCGCGCCGCGCCGGAGGAGGCCGAGACGCTGGCAGAGACCGAGCCAGAAAGGCACTTGGGGTCTTATCTGTTGGACTCTGAAAACACTTCAGGCGCCCTTCCAAGGCTTCCCCAAACCCCTAAGCAGCCGCAGAAGCGCTCCCGAGCTGCCTTCTCCCACACTCAGGTGATCGAGTTGGAGAGGAAGTTCAGCCATCAGAAGTACCTGTCGGCCCCTGAACGGGCCCACCTGGCCAAGAACCTCAAGCTCACGGAGACCCAAGTGAAGATATGGTTCCAGAACAGACGCTATAAGACTAAGCGAAAGCAGCTCTCCTCGGAGCTGGGAGACTTGGAGAAGCACTCCTCTTTGCCGGCCCTGAAAGAGGAGGCCTTCTCCCGGGCCTCCCTGGTCTCCGTGTATAACAGCTATCCTTACTACCCATACCTGTACTGCGTGGGCAGCTGGAGCCCAGCTTTTTGGTAA; ; Translation Sequence: MLRVPEPRPG EAKAEGAAPP TPSKPLTSFL IQDILRDGAQ RQGGRTSSQR QRDPEPEPEPEPEGGRSRAG AQNDQLSTGP RAAPEEAETL AETEPERHLG SYLLDSENTS GALPRLPQTPKQPQKRSRAA FSHTQVIELE RKFSHQKYLS APERAHLAKN LKLTETQVKI WFQNRRYKTKRKQLSSELGD LEKHSSLPAL KEEAFSRASL VSVYNSYPYY PYLYCVGSWS PAFW
• Sequence Length: 234

• Species: Human
• Chromosome Location: 8p21.2
• OMIM Reference Number: 602041
• cDNA Size: 705bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for NKX3-1 cdna clone

NKX3-1 encodes a homeobox-containing transcription factor. This transcription factor functions as a negative regulator of epithelial cell growth in prostate tissue. Aberrant expression of NKX3-1 is associated with prostate tumor progression. Alternate splicing results in multiple transcript variants of NKX3-1.

Product Categories/Family for NKX3-1 cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 19923352
• NCBI GeneID: 4824
• NCBI Accession #: NP_006158.2
• NCBI GenBank Nucleotide #: NM_006167.3
• UniProt Accession #: Q99801
• NCBI Official Full Name: homeobox protein Nkx-3.1 isoform 1
• NCBI Official Synonym Full Names: NK3 homeobox 1
• NCBI Official Symbol: NKX3-1
• NCBI Official Synonym Symbols: NKX3; BAPX2; NKX3A; NKX3.1
• NCBI Protein Information: homeobox protein Nkx-3.1
• UniProt Protein Name: Homeobox protein Nkx-3.1
• Protein Family: Homeobox protein
• UniProt Gene Name: NKX3-1
• UniProt Synonym Gene Names: NKX3.1; NKX3A
• UniProt Entry Name: NKX31_HUMAN

NCBI Description

This gene encodes a homeobox-containing transcription factor. This transcription factor functions as a negative regulator of epithelial cell growth in prostate tissue. Aberrant expression of this gene is associated with prostate tumor progression. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

NKX3-1: Transcription factor, which binds preferentially the consensus sequence 5'-TAAGT[AG]-3' and can behave as a transcriptional repressor. Play an important role in normal prostate development, regulating proliferation of glandular epithelium and in the formation of ducts in prostate. Act as a tumor suppressor controlling prostate carcinogenesis, as shown by the ability to inhibit proliferation and invasion activities of PC-3 prostate cancer cells. Interacts with serum response factor (SRF). Interacts with SPDEF. Interacts with WDR77. Interacts with TOPORS which polyubiquitinates NKX3-1 and induces its proteasomal degradation. By androgens and, in the LNCAP cell line, by estrogens. Androgenic control may be lost in prostate cancer cells during tumor progression from an androgen-dependent to an androgen- independent phase. Highly expressed in the prostate and, at a lower level, in the testis. Belongs to the NK-3 homeobox family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Tumor suppressor; Transcription factor

Chromosomal Location of Human Ortholog: 8p21.2

Cellular Component: intracellular; nucleus

Molecular Function: androgen receptor activity; protein binding; estrogen receptor activity; protein self-association; sequence-specific DNA binding; histone deacetylase binding; estrogen receptor binding; caspase activator activity; transcription factor binding; protein kinase activator activity; transcription factor activity

Biological Process: transcription from RNA polymerase II promoter; salivary gland development; positive regulation of transcription, DNA-dependent; multicellular organismal development; heart development; negative regulation of insulin-like growth factor receptor signaling pathway; positive regulation of caspase activity; positive regulation of mitotic cell cycle; negative regulation of cell proliferation; regulation of transcription, DNA-dependent; positive regulation of cell proliferation; protein kinase B signaling cascade; negative regulation of mitotic cell cycle; negative regulation of epithelial cell proliferation; caspase activation; somitogenesis; pharyngeal system development; male gonad development; response to testosterone stimulus; positive regulation of phosphoinositide 3-kinase cascade; branching morphogenesis of a tube; positive regulation of protein kinase activity; positive regulation of cell division; androgen receptor signaling pathway; positive regulation of transcription from RNA polymerase II promoter; steroid hormone mediated signaling; positive regulation of protein amino acid phosphorylation; negative regulation of transcription, DNA-dependent; metanephros development