Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR78 cdna clone

WDR78 cDNA Clone

Gene Names
WDR78; DIC4
Synonyms
WDR78; WDR78 cDNA Clone; WDR78 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagtctctccggcaggcagtcacaagcagcagaacttcgggttgaacaatgccacacaaccaaagaagtctattagcttttttgctacaatgaaagcaacttcagtgaaaggatatactggtgcaaatcaaagcagaatggctgtgtccaaaaccgtgcttattccacctgaactgaaaactgtagaaaaaccaaatcccaatataaagacaacacaggtatttgacataaatggaactgatgttactccccgacctctttaccatccagatccacttactggtacagcaaaaccaagtaaactcttgacatcacaagaaggatcacttggatcagaatttatatcttcctatagcctttatcagaatacaataaatcctagtacgttagggcagtttacaaggtcagttttaggaagcagtacagtttctaagtcaagtgtatcagcaagtgaatcaatagcagaagacctggaagaaccatcctataaacgggaaagattgactagtttcacagatttgcaagttataagggcagcacctgaaaaaattgtaacaaaagaagacctggagaagaatatagagataatactcacagagacagaaacactgagattttttgacttgcccacagtcatggtctctgtagaatctgaagaagctgagaaagtaactcagagaaacaagaattatgaagtcctttgtagaaacagattaggcaatgacctatatgttgaaaggatgatgcagactttcaatggagcaccaaagaataaagatgttcaatgtgataaaatcataatggaagataaaggcataatgtccactgcctgggatttgtatgattcttacaatgctatggaacttgtatctttatcagtaaaacaatctgtggttgagtcaagtagtaaagcaaatgtacttcctaaagatcaggaccaaagattgccagggagcactacagaaaaaaatagtgaaactagttctctaatggacatagaaaatgtaattctggcaaaaatccatgaagatgaggaagaccactcagatgcaatattaaaatctgacaaatttcatcaggacttattttttatggaacgggttctgatggaaaatatatttcagcccaaacttgcagcttatcgtcagcttcctgttttaaaagaacctgaacctgaagagcctgaagatgttttagaaagtgcaaaacatgaagaggtagaggaagaatctaagaaggaggaggaagaagaaatacatgcagaagaatcaacaatacccgccaacttggaacgactttggtctttttcctgtgacttaaccaaaggcctcaatgtgagcagccttgcctggaataaaacaaatccagatcttttggctgttggctatgggcactttggatttaaagagcaaaaaagaggactggcttgctgctggtcaataaagaatcccatggtaacccaaacaagaataagaagcatttttatctggctgttgacaaaattctcataa
Sequence Length
1515
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,213 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 78, mRNA
NCBI Official Synonym Full Names
WD repeat domain 78
NCBI Official Symbol
WDR78
NCBI Official Synonym Symbols
DIC4
NCBI Protein Information
WD repeat-containing protein 78
UniProt Protein Name
WD repeat-containing protein 78
UniProt Gene Name
WDR78
UniProt Entry Name
WDR78_HUMAN

Uniprot Description

WDR78: 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 1p31.3

Similar Products

Product Notes

The WDR78 wdr78 (Catalog #AAA1278984) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagtct ctccggcagg cagtcacaag cagcagaact tcgggttgaa caatgccaca caaccaaaga agtctattag cttttttgct acaatgaaag caacttcagt gaaaggatat actggtgcaa atcaaagcag aatggctgtg tccaaaaccg tgcttattcc acctgaactg aaaactgtag aaaaaccaaa tcccaatata aagacaacac aggtatttga cataaatgga actgatgtta ctccccgacc tctttaccat ccagatccac ttactggtac agcaaaacca agtaaactct tgacatcaca agaaggatca cttggatcag aatttatatc ttcctatagc ctttatcaga atacaataaa tcctagtacg ttagggcagt ttacaaggtc agttttagga agcagtacag tttctaagtc aagtgtatca gcaagtgaat caatagcaga agacctggaa gaaccatcct ataaacggga aagattgact agtttcacag atttgcaagt tataagggca gcacctgaaa aaattgtaac aaaagaagac ctggagaaga atatagagat aatactcaca gagacagaaa cactgagatt ttttgacttg cccacagtca tggtctctgt agaatctgaa gaagctgaga aagtaactca gagaaacaag aattatgaag tcctttgtag aaacagatta ggcaatgacc tatatgttga aaggatgatg cagactttca atggagcacc aaagaataaa gatgttcaat gtgataaaat cataatggaa gataaaggca taatgtccac tgcctgggat ttgtatgatt cttacaatgc tatggaactt gtatctttat cagtaaaaca atctgtggtt gagtcaagta gtaaagcaaa tgtacttcct aaagatcagg accaaagatt gccagggagc actacagaaa aaaatagtga aactagttct ctaatggaca tagaaaatgt aattctggca aaaatccatg aagatgagga agaccactca gatgcaatat taaaatctga caaatttcat caggacttat tttttatgga acgggttctg atggaaaata tatttcagcc caaacttgca gcttatcgtc agcttcctgt tttaaaagaa cctgaacctg aagagcctga agatgtttta gaaagtgcaa aacatgaaga ggtagaggaa gaatctaaga aggaggagga agaagaaata catgcagaag aatcaacaat acccgccaac ttggaacgac tttggtcttt ttcctgtgac ttaaccaaag gcctcaatgt gagcagcctt gcctggaata aaacaaatcc agatcttttg gctgttggct atgggcactt tggatttaaa gagcaaaaaa gaggactggc ttgctgctgg tcaataaaga atcccatggt aacccaaaca agaataagaa gcatttttat ctggctgttg acaaaattct cataa. It is sometimes possible for the material contained within the vial of "WDR78, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.