EIF4A2 cdna clone

EIF4A2 cDNA Clone

Gene Names

EIF4A2; DDX2B; EIF4A; EIF4F; BM-010; eIF4A-II; eIF-4A-II

Synonyms

EIF4A2; EIF4A2 cDNA Clone; EIF4A2 cdna clone

Ordering
Cat. Num. AAA1278951 For Research Use Only!

Sequence

atgtctggtggctccgcggattataacagcagagaacatggcggcccagagggaatggaccccgatggtgtcatcgagagcaactggaatgagattgttgataactttgatgatatgaatttaaaggagtctctccttcgtggcatctatgcttacggttttgagaagccttccgctattcagcagagagctattattccctgtattaaagggtatgatgtgattgctcaagctcagtcaggtactggcaagacagccacatttgccatttccatcctgcaacagttggagattgagttcaaggagacccaagcactagtattggcccccaccagagaactggctcaacagatccaaaaggtaattctggcacttggagactatatgggagccacttgtcatgcctgcattggtggaacaaatgttcgaaatgaaatgcaaaaactgcaggctgaagcaccacatattgttgttggtacacccgggagagtgtttgatatgttaaacagaagatacctttctccaaaatggatcaaaatgtttgttttggatgaagcagatgaaatgttgagccgtggttttaaggatcaaatctatgagattttccaaaaactaaacacaagtattcaggttgtgttgctttctgccacaatgccaactgatgtgttggaagtgaccaaaaaattcatgagagatccaattcgaattctggtgaaaaaggaagaattgacccttgaaggaatcaaacagttttatattaatgttgagagagaggaatggaagttggatacactttgtgacttgtacgagacactgaccattacacaggctgttatttttctcaatacgaggcgcaaggtggactggctgactgagaagatgcatgccagagacttcacagtttctgctctgcatggtgacatggaccagaaggagagagatgttatcatgagggaattccggtcagggtcaagtcgtgttctgatcactactgacttgttggctcgcgggattgatgtgcaacaagtgtctttggttataaattatgatctacctaccaatcgtgaaaactatattcacagaattggcagagggggtcgatttgggaggaaaggtgtggctataaactttgttactgaagaagacaagaggattcttcgtgacattgagactttctacaatactacagtggaggagatgcccatgaatgtggctgaccttatttaa

Sequence Length

1227

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

15214820

NCBI GeneID

1974

Molecular Weight

46,489 Da

NCBI Official Full Name

Homo sapiens eukaryotic translation initiation factor 4A, isoform 2, mRNA

NCBI Official Synonym Full Names

eukaryotic translation initiation factor 4A2

NCBI Official Symbol

EIF4A2

NCBI Official Synonym Symbols

DDX2B; EIF4A; EIF4F; BM-010; eIF4A-II; eIF-4A-II

NCBI Protein Information

eukaryotic initiation factor 4A-II

UniProt Protein Name

Eukaryotic initiation factor 4A-II

Protein Family

Eukaryotic initiation factor

UniProt Gene Name

EIF4A2

UniProt Synonym Gene Names

DDX2B; EIF4F; eIF-4A-II; eIF4A-II

UniProt Entry Name

IF4A2_HUMAN

Uniprot Description

EIF4A2: ATP-dependent RNA helicase which is a subunit of the eIF4F complex involved in cap recognition and is required for mRNA binding to ribosome. In the current model of translation initiation, eIF4A unwinds RNA secondary structures in the 5'-UTR of mRNAs which is necessary to allow efficient binding of the small ribosomal subunit, and subsequent scanning for the initiator codon. Belongs to the DEAD box helicase family. eIF4A subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation; RNA-binding; Helicase; EC 3.6.4.13; Translation initiation

Chromosomal Location of Human Ortholog: 3q28

Cellular Component: cytosol; eukaryotic translation initiation factor 4F complex; perinuclear region of cytoplasm

Molecular Function: ATP-dependent RNA helicase activity; ATPase activity; helicase activity; protein binding

Biological Process: poly(A) tail shortening; RNA secondary structure unwinding; translational initiation

Research Articles on EIF4A2

1. expression is an independent prognostic factor for patients with non-small-cell lung cancer for both overall survival and disease-free survival

Similar Products

Product Notes

The EIF4A2 eif4a2 (Catalog #AAA1278951) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctggtg gctccgcgga ttataacagc agagaacatg gcggcccaga gggaatggac cccgatggtg tcatcgagag caactggaat gagattgttg ataactttga tgatatgaat ttaaaggagt ctctccttcg tggcatctat gcttacggtt ttgagaagcc ttccgctatt cagcagagag ctattattcc ctgtattaaa gggtatgatg tgattgctca agctcagtca ggtactggca agacagccac atttgccatt tccatcctgc aacagttgga gattgagttc aaggagaccc aagcactagt attggccccc accagagaac tggctcaaca gatccaaaag gtaattctgg cacttggaga ctatatggga gccacttgtc atgcctgcat tggtggaaca aatgttcgaa atgaaatgca aaaactgcag gctgaagcac cacatattgt tgttggtaca cccgggagag tgtttgatat gttaaacaga agataccttt ctccaaaatg gatcaaaatg tttgttttgg atgaagcaga tgaaatgttg agccgtggtt ttaaggatca aatctatgag attttccaaa aactaaacac aagtattcag gttgtgttgc tttctgccac aatgccaact gatgtgttgg aagtgaccaa aaaattcatg agagatccaa ttcgaattct ggtgaaaaag gaagaattga cccttgaagg aatcaaacag ttttatatta atgttgagag agaggaatgg aagttggata cactttgtga cttgtacgag acactgacca ttacacaggc tgttattttt ctcaatacga ggcgcaaggt ggactggctg actgagaaga tgcatgccag agacttcaca gtttctgctc tgcatggtga catggaccag aaggagagag atgttatcat gagggaattc cggtcagggt caagtcgtgt tctgatcact actgacttgt tggctcgcgg gattgatgtg caacaagtgt ctttggttat aaattatgat ctacctacca atcgtgaaaa ctatattcac agaattggca gagggggtcg atttgggagg aaaggtgtgg ctataaactt tgttactgaa gaagacaaga ggattcttcg tgacattgag actttctaca atactacagt ggaggagatg cccatgaatg tggctgacct tatttaa. It is sometimes possible for the material contained within the vial of "EIF4A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

EIF4A2 cdna clone