Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IREB2 cdna clone

IREB2 cDNA Clone

Gene Names
IREB2; ACO3; IRP2; IRP2AD
Synonyms
IREB2; IREB2 cDNA Clone; IREB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgccccaaaagcaggatacgcctttgagtaccttattgaaacattaaatgacagttcacataagaagttcttcgatgtatctaaacttggcaccaagtatgatgttctgccttactcaatacgggtcttgttggaagctgctgtacgaaattgtgatggctttttaatgaagaaggaagatgttatgaacattttagactggaaaaccaaacaaagcaatgttgaagtgccctttttccctgcccgtgttcttcttcaagattttactggaataccagcaatggtggattttgctgctatgagggaggcagtgaaaactcttggaggtgatcctgagaaagtccatcctgcttgtccgacagatcttacagttgaccattctttacaaattgacttcagtaaatgtgcaatacagaatgcaccaaatcctggaggtggtgacctgcagaaagcaggaaagctctctccacttaaagtgcagcctaagaagcttccctgcagaggccagactacctgccgaggatcttgtgattctggagaactaggccgaaactcaggaacattttcttcgcagattgagaatacacccatcctgtgtccttttcatttgcaaccagtgcctgaacctgaaacagtgttaaaaaatcaagaagtagaattcggcagaaatcgagagaggcttcagttttttaagtggagttcaagagtttttaagaatgtggcagtgatccctcctggaactggaatggctcatcaaataaacttagaatatttgtcaagagtggtttttgaagaaaaagacctcctcttcccagacagtgtagtcggcacagattcacacataacgatggtgaatggtttagggattctggggtggggggttggaggcattgaaacagaagcagttatgcttggtctgccagtttctcttactttaccagaggtggttggatgtgagttaactgggtcatcaaacccttttgttacatccattgatgttgttcttggtattacaaaggtaagttaa
Sequence Length
1032
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,487 Da
NCBI Official Full Name
Homo sapiens iron-responsive element binding protein 2, mRNA
NCBI Official Synonym Full Names
iron responsive element binding protein 2
NCBI Official Symbol
IREB2
NCBI Official Synonym Symbols
ACO3; IRP2; IRP2AD
NCBI Protein Information
iron-responsive element-binding protein 2
UniProt Protein Name
Iron-responsive element-binding protein 2
UniProt Gene Name
IREB2
UniProt Synonym Gene Names
IRE-BP 2; IRP2
UniProt Entry Name
IREB2_HUMAN

Uniprot Description

IREB2: RNA-binding protein that binds to iron-responsive elements (IRES), which are stem-loop structures found in the 5'- UTR of ferritin, and delta aminolevulinic acid synthase mRNAs, and in the 3'-UTR of transferrin receptor mRNA. Binding to the IRE element in ferritin results in the repression of its mRNA translation. Binding of the protein to the transferrin receptor mRNA inhibits the degradation of this otherwise rapidly degraded mRNA. Belongs to the aconitase/IPM isomerase family.

Protein type: Translation; RNA-binding

Chromosomal Location of Human Ortholog: 15q25.1

Molecular Function: iron-responsive element binding; protein binding; RNA binding

Biological Process: iron ion transport

Research Articles on IREB2

Similar Products

Product Notes

The IREB2 ireb2 (Catalog #AAA1278901) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgccc caaaagcagg atacgccttt gagtacctta ttgaaacatt aaatgacagt tcacataaga agttcttcga tgtatctaaa cttggcacca agtatgatgt tctgccttac tcaatacggg tcttgttgga agctgctgta cgaaattgtg atggcttttt aatgaagaag gaagatgtta tgaacatttt agactggaaa accaaacaaa gcaatgttga agtgcccttt ttccctgccc gtgttcttct tcaagatttt actggaatac cagcaatggt ggattttgct gctatgaggg aggcagtgaa aactcttgga ggtgatcctg agaaagtcca tcctgcttgt ccgacagatc ttacagttga ccattcttta caaattgact tcagtaaatg tgcaatacag aatgcaccaa atcctggagg tggtgacctg cagaaagcag gaaagctctc tccacttaaa gtgcagccta agaagcttcc ctgcagaggc cagactacct gccgaggatc ttgtgattct ggagaactag gccgaaactc aggaacattt tcttcgcaga ttgagaatac acccatcctg tgtccttttc atttgcaacc agtgcctgaa cctgaaacag tgttaaaaaa tcaagaagta gaattcggca gaaatcgaga gaggcttcag ttttttaagt ggagttcaag agtttttaag aatgtggcag tgatccctcc tggaactgga atggctcatc aaataaactt agaatatttg tcaagagtgg tttttgaaga aaaagacctc ctcttcccag acagtgtagt cggcacagat tcacacataa cgatggtgaa tggtttaggg attctggggt ggggggttgg aggcattgaa acagaagcag ttatgcttgg tctgccagtt tctcttactt taccagaggt ggttggatgt gagttaactg ggtcatcaaa cccttttgtt acatccattg atgttgttct tggtattaca aaggtaagtt aa. It is sometimes possible for the material contained within the vial of "IREB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.