EPYC cdna clone
EPYC cDNA Clone
Gene Names
EPYC; PGLB; DSPG3; Pg-Lb; SLRR3B
Synonyms
EPYC; EPYC cDNA Clone; EPYC cdna clone
Sequence
atgaagacattagcaggacttgttctgggacttgtcatctttgatgctgctgtgactgccccaactctagagtccatcaactatgactcagaaacctatgatgccaccttagaagacctggataatttgtacaactatgaaaacatacctgttggtaaagttgagattgaaatagccacagtgatgccttcagggaacagagagctcctcactccacccccacagcctgagaaggcccaggaagaggaagaggaggaggaatctactcccaggctgattgatggctcttctccccaggagcctgaattcacaggggttctggggccacacacaaatgaagactttccaacctgtcttttgtgtacttgtataagtaccaccgtgtactgtgatgaccatgaacttgatgctattcctccgctgccaaagaacaccgcttatttctattcccgctttaacagaattaaaaagatcaacaaaaatgactttgcaagcctaagtgatttaaaaaggattgatctgacatcaaatttaatatctgagattgatgaagatgcattccgaaaactgcctcaacttcgagagcttgtcctgcgtgacaacaaaataaggcagctcccagaattgccaaccactttgacatttattgatattagcaacaatagacttggaaggaaagggataaagcaagaagcatttaaagacatgtatgatctccatcatctgtacctcactgataacaacttggaccacatccctctgccactcccagaaaatctacgagcccttcacctccagaataacaacattctggaaatgcacgaagatacgttctgcaatgttaaaaatttgacttatattcgtaaggcactagaggacattcgattggatggaaaccctattaatctcagcaaaactcctcaagcatacatgtgtctacctcgtctgcctgttgggagccttgtctaa
Sequence Length
969
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,637 Da
NCBI Official Full Name
Homo sapiens epiphycan, mRNA
NCBI Official Synonym Full Names
epiphycan
NCBI Official Symbol
EPYC
NCBI Official Synonym Symbols
PGLB; DSPG3; Pg-Lb; SLRR3B
NCBI Protein Information
epiphycan
UniProt Protein Name
Epiphycan
Protein Family
UniProt Gene Name
EPYC
UniProt Synonym Gene Names
DSPG3; PGLB; SLRR3B; PG-Lb
UniProt Entry Name
EPYC_HUMAN
NCBI Description
Dermatan sulfate proteoglycan 3 is a member of the small leucine-rich repeat proteoglycan family. This gene is composed of seven exons. It regulates fibrillogenesis by interacting with collagen fibrils and other extracellular matrix proteins. [provided by RefSeq, Jul 2008]
Uniprot Description
EPYC: May have a role in bone formation and also in establishing the ordered structure of cartilage through matrix organization. Belongs to the small leucine-rich proteoglycan (SLRP) family. SLRP class III subfamily.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 12q21
Cellular Component: extracellular space; proteinaceous extracellular matrix
Molecular Function: glycosaminoglycan binding; heparin binding; Roundabout binding
Biological Process: axon extension involved in axon guidance; axonogenesis; female pregnancy; regulation of axonogenesis
Research Articles on EPYC
Similar Products
Product Notes
The EPYC epyc (Catalog #AAA1278897) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagacat tagcaggact tgttctggga cttgtcatct ttgatgctgc tgtgactgcc ccaactctag agtccatcaa ctatgactca gaaacctatg atgccacctt agaagacctg gataatttgt acaactatga aaacatacct gttggtaaag ttgagattga aatagccaca gtgatgcctt cagggaacag agagctcctc actccacccc cacagcctga gaaggcccag gaagaggaag aggaggagga atctactccc aggctgattg atggctcttc tccccaggag cctgaattca caggggttct ggggccacac acaaatgaag actttccaac ctgtcttttg tgtacttgta taagtaccac cgtgtactgt gatgaccatg aacttgatgc tattcctccg ctgccaaaga acaccgctta tttctattcc cgctttaaca gaattaaaaa gatcaacaaa aatgactttg caagcctaag tgatttaaaa aggattgatc tgacatcaaa tttaatatct gagattgatg aagatgcatt ccgaaaactg cctcaacttc gagagcttgt cctgcgtgac aacaaaataa ggcagctccc agaattgcca accactttga catttattga tattagcaac aatagacttg gaaggaaagg gataaagcaa gaagcattta aagacatgta tgatctccat catctgtacc tcactgataa caacttggac cacatccctc tgccactccc agaaaatcta cgagcccttc acctccagaa taacaacatt ctggaaatgc acgaagatac gttctgcaat gttaaaaatt tgacttatat tcgtaaggca ctagaggaca ttcgattgga tggaaaccct attaatctca gcaaaactcc tcaagcatac atgtgtctac ctcgtctgcc tgttgggagc cttgtctaa. It is sometimes possible for the material contained within the vial of "EPYC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
