ZSCAN20 cdna clone
ZSCAN20 cDNA Clone
Gene Names
ZSCAN20; KOX29; ZNF31; ZFP-31; ZNF360
Synonyms
ZSCAN20; ZSCAN20 cDNA Clone; ZSCAN20 cdna clone
Sequence
atggctatggccctggaattgcaagcccaggcatctccgcagccagagcctgaagaactcctgattgtgaaactggaagaggactcttggggatcagaatccaaactctgggagaaggaccgtggctctgtctctggcccagaggcctcccgccagcgcttcaggcaattccaatacagggatgcagctggaccccacgaggccttcagccagctctgggctctctgctgtcgttggctgaggccggagatccgtctcaaagagcagatcctggagctgctcgtgctggagcagttcctgactatcttgcctagggaggtccagacctgggtgcaggcacgccaccctgagagtggtgaggaggctgtggccttggtggaggattggcaccgagagaccaggactgcaggacagtcgggactggaattgcatacagaagagaccaggcccttaaagacaggggaagaagctcagagcttccagctgcagccagtggatccctggcctgagggacagtcccagaagaagggggtgaagaatacatgccctgaccttcccaatcacctaaatgccgaggtggcaccacagcctttgaaagagagtggagttccagtttcaaaaccaagtaatacctccgagaaagagcaaggaccagagttttggggtctaagtcttataaattctgggaaaaggagcactgcagattacagcctggataatgagccagctcaggcattgacctggagggattcaagagcctgggaggaacaataccagtgggatgtggaggacatgaaggtgtcaggtgttcactggggctatgaggagaccaagactttcctggcaattttgagtgaatctcctttctctgaaaagctccggacttgtcaccagaaccgccaggtatatcgggccattgcagagcagctaagggcaaggggcttcctgcggacactggagcaatgtcgctatagggtcaaaaacctcctacggaattaccggaaagccaagagcagccacccaccaggtacctgccccttctatgaggagctggaggccctggtcagggctcggacagccatcagagccacagatggcccaggagaggccgtggcacttcccaggctcggggatagtgacgcagagatggatgagcaggaggaagggggctgggatcctgaagaaatggcagaagactgtaacggtgctggcctggtcaatgttgagtctacccaggggcccaggattgcaggggccccagctctgttccagagtcgtattggtaagaacatgggggtttag
Sequence Length
1302
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,035 Da
NCBI Official Full Name
Homo sapiens zinc finger and SCAN domain containing 20, mRNA
NCBI Official Synonym Full Names
zinc finger and SCAN domain containing 20
NCBI Official Symbol
ZSCAN20
NCBI Official Synonym Symbols
KOX29; ZNF31; ZFP-31; ZNF360
NCBI Protein Information
zinc finger and SCAN domain-containing protein 20
UniProt Protein Name
Zinc finger and SCAN domain-containing protein 20
Protein Family
UniProt Gene Name
ZSCAN20
UniProt Synonym Gene Names
KOX29; ZNF31; ZNF360
UniProt Entry Name
ZSC20_HUMAN
Uniprot Description
ZSCAN20: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor; DNA-binding; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 1p34.3
Molecular Function: transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Research Articles on ZSCAN20
Similar Products
Product Notes
The ZSCAN20 zscan20 (Catalog #AAA1278862) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctatgg ccctggaatt gcaagcccag gcatctccgc agccagagcc tgaagaactc ctgattgtga aactggaaga ggactcttgg ggatcagaat ccaaactctg ggagaaggac cgtggctctg tctctggccc agaggcctcc cgccagcgct tcaggcaatt ccaatacagg gatgcagctg gaccccacga ggccttcagc cagctctggg ctctctgctg tcgttggctg aggccggaga tccgtctcaa agagcagatc ctggagctgc tcgtgctgga gcagttcctg actatcttgc ctagggaggt ccagacctgg gtgcaggcac gccaccctga gagtggtgag gaggctgtgg ccttggtgga ggattggcac cgagagacca ggactgcagg acagtcggga ctggaattgc atacagaaga gaccaggccc ttaaagacag gggaagaagc tcagagcttc cagctgcagc cagtggatcc ctggcctgag ggacagtccc agaagaaggg ggtgaagaat acatgccctg accttcccaa tcacctaaat gccgaggtgg caccacagcc tttgaaagag agtggagttc cagtttcaaa accaagtaat acctccgaga aagagcaagg accagagttt tggggtctaa gtcttataaa ttctgggaaa aggagcactg cagattacag cctggataat gagccagctc aggcattgac ctggagggat tcaagagcct gggaggaaca ataccagtgg gatgtggagg acatgaaggt gtcaggtgtt cactggggct atgaggagac caagactttc ctggcaattt tgagtgaatc tcctttctct gaaaagctcc ggacttgtca ccagaaccgc caggtatatc gggccattgc agagcagcta agggcaaggg gcttcctgcg gacactggag caatgtcgct atagggtcaa aaacctccta cggaattacc ggaaagccaa gagcagccac ccaccaggta cctgcccctt ctatgaggag ctggaggccc tggtcagggc tcggacagcc atcagagcca cagatggccc aggagaggcc gtggcacttc ccaggctcgg ggatagtgac gcagagatgg atgagcagga ggaagggggc tgggatcctg aagaaatggc agaagactgt aacggtgctg gcctggtcaa tgttgagtct acccaggggc ccaggattgc aggggcccca gctctgttcc agagtcgtat tggtaagaac atgggggttt ag. It is sometimes possible for the material contained within the vial of "ZSCAN20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
