Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LIN37 cdna clone

LIN37 cDNA Clone

Gene Names
LIN37; F25965; lin-37; ZK418.4
Synonyms
LIN37; LIN37 cDNA Clone; LIN37 cdna clone
Ordering
For Research Use Only!
Sequence
atgttccctgtgaaggtgaaagtggagaaatcagagctggagatggccaaagcccggaaccaactggatgctgtcttgcagtgtctgctggagaagagtcacatggacagggagcgtctggatgaggaagctgggaaaacaccctcagacacccacaataaggactgctccatcgcagccactggcaaaaggccatctgcccgcttcccccaccagcggaggaagaagaggagggagatggatgatgggctggctgagggagggccgcagcgatccaacacatatgtgatcaagctgttcgaccggagcgtggacttggcccagttcagcgagaacacgccactgtacccaatctgccgcgcctggatgcgcaacagcccctctgtgcgcgagcgtgaatgctctcccagctcacccctgcccccgctgcctgaggatgaggagggctcagaggtaaccaacagcaagagtcgtgatgtgtacaagctgccgccacccacacccccggggccacccggagatgcctgcagatcccgcatcccatctccactgcagcctgagatgcagggcacccctgacgatgagccctctgagcccgagccctcaccctccacactcatctatcgcaacatgcagcgctggaaacgcatccgccagaggtggaaggaggcctctcatcggaaccagcttcgttactcagaaagcatgaagatcctacgagagatgtacgaacgacagtga
Sequence Length
741
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,383 Da
NCBI Official Full Name
Homo sapiens lin-37 homolog (C. elegans), mRNA
NCBI Official Synonym Full Names
lin-37 DREAM MuvB core complex component
NCBI Official Symbol
LIN37
NCBI Official Synonym Symbols
F25965; lin-37; ZK418.4
NCBI Protein Information
protein lin-37 homolog
UniProt Protein Name
Protein lin-37 homolog
Protein Family
UniProt Gene Name
LIN37
UniProt Entry Name
LIN37_HUMAN

NCBI Description

This gene encodes a protein expressed in the eye. [provided by RefSeq, Jul 2008]

Uniprot Description

F25965: Component of the DREAM complex (also named LINC complex) at least composed of E2F4, E2F5, LIN9, LIN37, LIN52, LIN54, MYBL1, MYBL2, RBL1, RBL2, RBBP4, TFDP1 and TFDP2. The complex exists in quiescent cells where it represses cell cycle-dependent genes. It dissociates in S phase when LIN9, LIN37, LIN52 and LIN54 form a subcomplex that binds to MYBL2.

Chromosomal Location of Human Ortholog: 19q13.1

Cellular Component: nucleoplasm

Molecular Function: protein binding

Biological Process: regulation of cell cycle

Similar Products

Product Notes

The LIN37 lin37 (Catalog #AAA1278853) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccctg tgaaggtgaa agtggagaaa tcagagctgg agatggccaa agcccggaac caactggatg ctgtcttgca gtgtctgctg gagaagagtc acatggacag ggagcgtctg gatgaggaag ctgggaaaac accctcagac acccacaata aggactgctc catcgcagcc actggcaaaa ggccatctgc ccgcttcccc caccagcgga ggaagaagag gagggagatg gatgatgggc tggctgaggg agggccgcag cgatccaaca catatgtgat caagctgttc gaccggagcg tggacttggc ccagttcagc gagaacacgc cactgtaccc aatctgccgc gcctggatgc gcaacagccc ctctgtgcgc gagcgtgaat gctctcccag ctcacccctg cccccgctgc ctgaggatga ggagggctca gaggtaacca acagcaagag tcgtgatgtg tacaagctgc cgccacccac acccccgggg ccacccggag atgcctgcag atcccgcatc ccatctccac tgcagcctga gatgcagggc acccctgacg atgagccctc tgagcccgag ccctcaccct ccacactcat ctatcgcaac atgcagcgct ggaaacgcat ccgccagagg tggaaggagg cctctcatcg gaaccagctt cgttactcag aaagcatgaa gatcctacga gagatgtacg aacgacagtg a. It is sometimes possible for the material contained within the vial of "LIN37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.