ANKRD7 cdna clone
ANKRD7 cDNA Clone
Gene Names
ANKRD7; TSA806
Synonyms
ANKRD7; ANKRD7 cDNA Clone; ANKRD7 cdna clone
Sequence
atgcaggacaaaaaatacagaacacctttgcacctagcctgtgctaatggacatacagatgttgtacttttcctaattgagcaacaatgcaaaataaatgtccgggatagtgaaaacaaatccccattgattaaggcagtacagtgtcaaaatgaggattgtgctactattcttctaaactttggtgcagacccagatctgagggatattcgttataatactgttcttcactatgctgtttgtggtcaaagtttgtcattagttgaaaaactgcttgaatacgaagctgatcttgaagcgaaaaataaggatgggtatactccactattagttgccgttattaacaataatccaaaaatggtaaaatttcttctggagaaaggggctgatgtgaatgcttcagataattatcaaagaacagcccttattcttgctgtcagtggtgaaccaccatgtttagtaaagcttcttcttcagcaaggtgtggaattatgttacgaaggtattgtggattcacagctgaggaatatgtttatttccatggttttactgcatagatacccacaattcactgcgagccatggaaagaagaaacatgctaaatag
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,337 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 7, mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 7
NCBI Official Symbol
ANKRD7
NCBI Official Synonym Symbols
TSA806
NCBI Protein Information
ankyrin repeat domain-containing protein 7
UniProt Protein Name
Ankyrin repeat domain-containing protein 7
Protein Family
UniProt Gene Name
ANKRD7
UniProt Entry Name
ANKR7_HUMAN
Uniprot Description
ANKRD7: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell development/differentiation
Chromosomal Location of Human Ortholog: 7q31
Biological Process: male gonad development
Research Articles on ANKRD7
Similar Products
Product Notes
The ANKRD7 ankrd7 (Catalog #AAA1278843) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggaca aaaaatacag aacacctttg cacctagcct gtgctaatgg acatacagat gttgtacttt tcctaattga gcaacaatgc aaaataaatg tccgggatag tgaaaacaaa tccccattga ttaaggcagt acagtgtcaa aatgaggatt gtgctactat tcttctaaac tttggtgcag acccagatct gagggatatt cgttataata ctgttcttca ctatgctgtt tgtggtcaaa gtttgtcatt agttgaaaaa ctgcttgaat acgaagctga tcttgaagcg aaaaataagg atgggtatac tccactatta gttgccgtta ttaacaataa tccaaaaatg gtaaaatttc ttctggagaa aggggctgat gtgaatgctt cagataatta tcaaagaaca gcccttattc ttgctgtcag tggtgaacca ccatgtttag taaagcttct tcttcagcaa ggtgtggaat tatgttacga aggtattgtg gattcacagc tgaggaatat gtttatttcc atggttttac tgcatagata cccacaattc actgcgagcc atggaaagaa gaaacatgct aaatag. It is sometimes possible for the material contained within the vial of "ANKRD7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
