SYAP1 cdna clone
SYAP1 cDNA Clone
Gene Names
SYAP1; PRO3113
Synonyms
SYAP1; SYAP1 cDNA Clone; SYAP1 cdna clone
Sequence
atgttccggggcttgagcagttggttgggcttgcagcagccggtggcaggcggtgggcagcccaatggagatgctctacccgagcagccgtccgagacggtggctgagtctgcggaggaggagctgcagcaagcgggagaccaggagctcctccaccaggccaaagacttcggcaactatttatttaactttgcatctgctgccacaaaaaagataactgaatcagttgctgaaacagcacaaacaataaagaaatccgtagaagaaggaaaaatagatggcatcattgacaagacaattataggagattttcagaaggaacagaaaaaatttgttgaagagcaacatacaaagaagtcagaagcagctgtgcccccatgggttgacactaacgatgaagaaacaattcaacaacaaattttggccttatcagctgacaagaggaatttccttcgtgaccctccggctggcgtgcaatttaatttcgactttgatcagatgtaccccgtggccctggtcatgctccaggaggatgagctgctaagcaagatgagatttgccctcgttcctaaacttgtgaaggaagaagtgttctggaggaactacttttaccgcgtctccctgattaagcagtcagcccagctcacggccctggctgcccaacagcaggccgcagggaaggaggagaagagcaatggcagagagcaagatttgccgctggcagaggcagtacggcccaaaacgccacccgttgtaatcaaatctcagcttaaaactcaagaggatgaggaagaaatttctactagcccaggtgtttctgagtttgtcagtgatgccttcgatgcctgtaacctaaatcaggaagatctaaggaaagaaatggagcaactagtgcttgacaaaaagcaagaggagacagccgtactggaagaggattctgcagattgggaaaaagaactgcagcaggaacttcaagaatatgaagtggtgacagaatctgaaaaacgagatgaaaactgggataaggaaatagagaaaatgcttcaagaggaaaattag
Sequence Length
1059
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,933 Da
NCBI Official Full Name
Homo sapiens synapse associated protein 1, SAP47 homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
synapse associated protein 1
NCBI Official Symbol
SYAP1
NCBI Official Synonym Symbols
PRO3113
NCBI Protein Information
synapse-associated protein 1
UniProt Protein Name
Synapse-associated protein 1
Protein Family
UniProt Gene Name
SYAP1
UniProt Entry Name
SYAP1_HUMAN
Uniprot Description
SYAP1:
Protein type: Unknown function
Chromosomal Location of Human Ortholog: Xp22.2
Cellular Component: cytoplasm; Golgi apparatus; nucleoplasm
Molecular Function: protein binding
Research Articles on SYAP1
Similar Products
Product Notes
The SYAP1 syap1 (Catalog #AAA1278821) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccggg gcttgagcag ttggttgggc ttgcagcagc cggtggcagg cggtgggcag cccaatggag atgctctacc cgagcagccg tccgagacgg tggctgagtc tgcggaggag gagctgcagc aagcgggaga ccaggagctc ctccaccagg ccaaagactt cggcaactat ttatttaact ttgcatctgc tgccacaaaa aagataactg aatcagttgc tgaaacagca caaacaataa agaaatccgt agaagaagga aaaatagatg gcatcattga caagacaatt ataggagatt ttcagaagga acagaaaaaa tttgttgaag agcaacatac aaagaagtca gaagcagctg tgcccccatg ggttgacact aacgatgaag aaacaattca acaacaaatt ttggccttat cagctgacaa gaggaatttc cttcgtgacc ctccggctgg cgtgcaattt aatttcgact ttgatcagat gtaccccgtg gccctggtca tgctccagga ggatgagctg ctaagcaaga tgagatttgc cctcgttcct aaacttgtga aggaagaagt gttctggagg aactactttt accgcgtctc cctgattaag cagtcagccc agctcacggc cctggctgcc caacagcagg ccgcagggaa ggaggagaag agcaatggca gagagcaaga tttgccgctg gcagaggcag tacggcccaa aacgccaccc gttgtaatca aatctcagct taaaactcaa gaggatgagg aagaaatttc tactagccca ggtgtttctg agtttgtcag tgatgccttc gatgcctgta acctaaatca ggaagatcta aggaaagaaa tggagcaact agtgcttgac aaaaagcaag aggagacagc cgtactggaa gaggattctg cagattggga aaaagaactg cagcaggaac ttcaagaata tgaagtggtg acagaatctg aaaaacgaga tgaaaactgg gataaggaaa tagagaaaat gcttcaagag gaaaattag. It is sometimes possible for the material contained within the vial of "SYAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
