WDFY3 cdna clone
WDFY3 cDNA Clone
Gene Names
WDFY3; ALFY; ZFYVE25
Synonyms
WDFY3; WDFY3 cDNA Clone; WDFY3 cdna clone
Sequence
atgggcacctccaaagaaaaggccaagaccgtcaccctcaaacaggccttactgggccacactgataccgtcacctgcgccacagcatcattagcctatcacataattgtcagtgggtcccgtgatcgaacctgtatcatttgggatttgaacaaactgtcatttctaacccagcttcgagggcatcgagctccagtttctgctctttgtatcaatgaattaacaggggacattgtgtcctgcgctggcacatatatccatgtgtggagcatcaatgggaaccctatcgtgagtgtcaacacgttcacaggtaggagccagcagatcatctgctgctgcatgtcggagatgaacgaatgggacacgcagaacgtcatagtgacaggacactcagatggagtggttcggttttggagaatggaatttttgcaagttcctgaaacaccagctcctgagcctgctgaagtcctagaaatgcaggaagactgtccagaagcacaaatagggcaggaagcccaagacgaggacagcagtgattcagaagcagatgagcagagcatcagccaggaccctaaggacactccaagccaacccagcagcaccagccacaggccccgggcagcctcctgccgcgcaacagccgcctggtgtactgacagtggctctgacgactccagacgctggtccgaccagctcagtctagatgagaaagacggcttcatatttgtgaactattcagagggccagaccagagcccatctgcagggcccccttagccacccccaccccaatcccattgaggtgcggaattacagcagattgaaacctgggtaccgatgggaacggcagctggtgttcaggagtaagctgactatgcacacagcctttgatcgaaaggacaatgcacacccagctgaggtcactgccttgggcatctccaaggatcacagtaggatcctcgttggtgacagtcgaggccgagttttcagctggtctgtgagtgaccagccaggccgttctgctgctgatcactgggtgaaggatgaaggtggtgacagctgctcaggctgctcggtgaggttttcactcacagaaagacgacaccattgcaggaactgtggtcagctcttctgccagaagtgcagtcgctttcaatctgaaatcaaacgcttgaaaatctcatccccggtgcgtgtttgtcagaactgttattataacttacagcatgagagaggttcagaagatgggcctcgaaattgttga
Sequence Length
1263
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
393,367 Da
NCBI Official Full Name
Homo sapiens WD repeat and FYVE domain containing 3, mRNA
NCBI Official Synonym Full Names
WD repeat and FYVE domain containing 3
NCBI Official Symbol
WDFY3
NCBI Official Synonym Symbols
ALFY; ZFYVE25
NCBI Protein Information
WD repeat and FYVE domain-containing protein 3
UniProt Protein Name
WD repeat and FYVE domain-containing protein 3
Protein Family
UniProt Gene Name
WDFY3
UniProt Synonym Gene Names
KIAA0993; Alfy
UniProt Entry Name
WDFY3_HUMAN
NCBI Description
This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
Uniprot Description
WDFY3: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Lipid-binding; Nuclear envelope; Transferase; Membrane protein, peripheral
Chromosomal Location of Human Ortholog: 4q21.23
Cellular Component: autophagic vacuole; cytoplasm; extrinsic to membrane; inclusion body; nuclear envelope; PML body
Molecular Function: phosphatidylinositol binding; protein binding
Research Articles on WDFY3
Similar Products
Product Notes
The WDFY3 wdfy3 (Catalog #AAA1278820) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcacct ccaaagaaaa ggccaagacc gtcaccctca aacaggcctt actgggccac actgataccg tcacctgcgc cacagcatca ttagcctatc acataattgt cagtgggtcc cgtgatcgaa cctgtatcat ttgggatttg aacaaactgt catttctaac ccagcttcga gggcatcgag ctccagtttc tgctctttgt atcaatgaat taacagggga cattgtgtcc tgcgctggca catatatcca tgtgtggagc atcaatggga accctatcgt gagtgtcaac acgttcacag gtaggagcca gcagatcatc tgctgctgca tgtcggagat gaacgaatgg gacacgcaga acgtcatagt gacaggacac tcagatggag tggttcggtt ttggagaatg gaatttttgc aagttcctga aacaccagct cctgagcctg ctgaagtcct agaaatgcag gaagactgtc cagaagcaca aatagggcag gaagcccaag acgaggacag cagtgattca gaagcagatg agcagagcat cagccaggac cctaaggaca ctccaagcca acccagcagc accagccaca ggccccgggc agcctcctgc cgcgcaacag ccgcctggtg tactgacagt ggctctgacg actccagacg ctggtccgac cagctcagtc tagatgagaa agacggcttc atatttgtga actattcaga gggccagacc agagcccatc tgcagggccc ccttagccac ccccacccca atcccattga ggtgcggaat tacagcagat tgaaacctgg gtaccgatgg gaacggcagc tggtgttcag gagtaagctg actatgcaca cagcctttga tcgaaaggac aatgcacacc cagctgaggt cactgccttg ggcatctcca aggatcacag taggatcctc gttggtgaca gtcgaggccg agttttcagc tggtctgtga gtgaccagcc aggccgttct gctgctgatc actgggtgaa ggatgaaggt ggtgacagct gctcaggctg ctcggtgagg ttttcactca cagaaagacg acaccattgc aggaactgtg gtcagctctt ctgccagaag tgcagtcgct ttcaatctga aatcaaacgc ttgaaaatct catccccggt gcgtgtttgt cagaactgtt attataactt acagcatgag agaggttcag aagatgggcc tcgaaattgt tga. It is sometimes possible for the material contained within the vial of "WDFY3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
