PDIA6 cdna clone
PDIA6 cDNA Clone
Gene Names
PDIA6; P5; ERP5; TXNDC7
Synonyms
PDIA6; PDIA6 cDNA Clone; PDIA6 cdna clone
Sequence
atggctctcctggtgctcggtctggtgagctgtaccttctttctggcagtgaatggtctgtattcctctagtgatgatgtgatcgaattaactccatcgaatttcaaccgagaagttattcagagtgatagtttgtggcttgtagaattctatgctccatggtgtggtcactgtcaaagattaacaccagaatggaagaaagcagcaactgcattaaaagatgttgtcaaagttggtgcagttgatgcagataagcatcattccctaggaggtcagtatggtgttcagggatttcctaccattaagatttttggatccaacaaaaacagaccagaagattaccaaggtggcagaactggtgaagccattgtagatgctgcgctgagtgctctgcgccagctcgtgaaggatcgcctcgggggacggagcggaggatacagttctggaaaacaaggcagaagtgatagttcaagtaagaaggatgtgattgagctgacagacgacagctttgataagaatgttctggacagtgaagatgtttggatggttgagttctatgctccttggtgtggacactgcaaaaacctagagccagagtgggctgccgcagcttcagaagtaaaagagcagacgaaaggaaaagtgaaactggcagctgtggatgctacagtcaatcaggttctggcctcccgatacgggattagaggatttcctacaatcaagatatttcagaaaggcgagtctcctgtggattatgacggtgggcggacaagatccgacatcgtgtcccgggcccttgatttgttttctgataacgccccacctcctgagctgcttgagattatcaacgaggacattgccaagaggacgtgtgaggagcaccagctctgtgttgtggctgtgctgccccatatccttgatactggagctgcaggcagaaattcttatctggaagttcttctgaagttggcagacaaatacaaaaagaaaatgtgggggtggctgtggacagaagctggagcccagtctgaacttgagaccgcgttggggattggagggtttgggtaccccgccatggccgccatcaatgcacgcaagatgaaatttgctctgctaaaaggctccttcagtgagcaaggcatcaacgagtttctcagggagctctcttttgggcgtggctccacggcacctgtaggaggcggggctttccctaccatcgttgagagagagccttgggacggcagggatggcgagcttcccgtggaggatgacattgacctcagtgatgtggagcttgatgacttagggaaagatgagttgtga
Sequence Length
1323
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,261 Da
NCBI Official Full Name
Homo sapiens protein disulfide isomerase family A, member 6, mRNA
NCBI Official Synonym Full Names
protein disulfide isomerase family A member 6
NCBI Official Symbol
PDIA6
NCBI Official Synonym Symbols
P5; ERP5; TXNDC7
NCBI Protein Information
protein disulfide-isomerase A6
UniProt Protein Name
Protein disulfide-isomerase A6
Protein Family
UniProt Gene Name
PDIA6
UniProt Synonym Gene Names
ERP5; P5; TXNDC7; ER protein 5; ERp5
UniProt Entry Name
PDIA6_HUMAN
NCBI Description
Protein disulfide isomerases (EC 5.3.4.1), such as PDIA6, are endoplasmic reticulum (ER) resident proteins that catalyze formation, reduction, and isomerization of disulfide bonds in proteins and are thought to play a role in folding of disulfide-bonded proteins (Hayano and Kikuchi, 1995 [PubMed 7590364]).[supplied by OMIM, Mar 2008]
Uniprot Description
PDIA6: May function as a chaperone that inhibits aggregation of misfolded proteins. Plays a role in platelet aggregation and activation by agonists such as convulxin, collagen and thrombin. Belongs to the protein disulfide isomerase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 5.3.4.1; Isomerase
Chromosomal Location of Human Ortholog: 2p25.1
Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; ER-Golgi intermediate compartment
Molecular Function: protein binding
Biological Process: apoptotic cell clearance; protein folding
Research Articles on PDIA6
Similar Products
Product Notes
The PDIA6 pdia6 (Catalog #AAA1278686) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctcc tggtgctcgg tctggtgagc tgtaccttct ttctggcagt gaatggtctg tattcctcta gtgatgatgt gatcgaatta actccatcga atttcaaccg agaagttatt cagagtgata gtttgtggct tgtagaattc tatgctccat ggtgtggtca ctgtcaaaga ttaacaccag aatggaagaa agcagcaact gcattaaaag atgttgtcaa agttggtgca gttgatgcag ataagcatca ttccctagga ggtcagtatg gtgttcaggg atttcctacc attaagattt ttggatccaa caaaaacaga ccagaagatt accaaggtgg cagaactggt gaagccattg tagatgctgc gctgagtgct ctgcgccagc tcgtgaagga tcgcctcggg ggacggagcg gaggatacag ttctggaaaa caaggcagaa gtgatagttc aagtaagaag gatgtgattg agctgacaga cgacagcttt gataagaatg ttctggacag tgaagatgtt tggatggttg agttctatgc tccttggtgt ggacactgca aaaacctaga gccagagtgg gctgccgcag cttcagaagt aaaagagcag acgaaaggaa aagtgaaact ggcagctgtg gatgctacag tcaatcaggt tctggcctcc cgatacggga ttagaggatt tcctacaatc aagatatttc agaaaggcga gtctcctgtg gattatgacg gtgggcggac aagatccgac atcgtgtccc gggcccttga tttgttttct gataacgccc cacctcctga gctgcttgag attatcaacg aggacattgc caagaggacg tgtgaggagc accagctctg tgttgtggct gtgctgcccc atatccttga tactggagct gcaggcagaa attcttatct ggaagttctt ctgaagttgg cagacaaata caaaaagaaa atgtgggggt ggctgtggac agaagctgga gcccagtctg aacttgagac cgcgttgggg attggagggt ttgggtaccc cgccatggcc gccatcaatg cacgcaagat gaaatttgct ctgctaaaag gctccttcag tgagcaaggc atcaacgagt ttctcaggga gctctctttt gggcgtggct ccacggcacc tgtaggaggc ggggctttcc ctaccatcgt tgagagagag ccttgggacg gcagggatgg cgagcttccc gtggaggatg acattgacct cagtgatgtg gagcttgatg acttagggaa agatgagttg tga. It is sometimes possible for the material contained within the vial of "PDIA6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
