TNFAIP3 cdna clone

TNFAIP3 cDNA Clone

Cat. Num. AAA1278667

• Gene Names: TNFAIP3; A20; AISBL; OTUD7C; TNFA1P2
• Synonyms: TNFAIP3; TNFAIP3 cDNA Clone; TNFAIP3 cdna clone

• Sequence: ATGGCTGAACAAGTCCTTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCATGGCCCGAAGTGGACTTCAGTACAACTCACTGGAAGAAATACACATATTTGTCCTTTGCAACATCCTCAGAAGGCCAATCATTGTCATTTCAGACAAAATGCTAAGAAGTTTGGAATCAGGTTCCAATTTCGCCCCTTTGAAAGTGGGTGGAATTTACTTGCCTCTCCACTGGCCTGCCCAGGAATGCTACAGATACCCCATTGTTCTCGGCTATGACAGCCATCATTTTGTACCCTTGGTGACCCTGAAGGACAGTGGGCCTGAAATCCGAGCTGTTCCACTTGTTAACAGAGACCGGGGAAGATTTGAAGACTTAAAAGTTCACTTTTTGACAGATCCTGAAAATGAGATGAAGGAGAAGCTCTTAAAAGAGTACTTAATGGTGATAGAAATCCCCGTCCAAGGCTGGGACCATGGCACAACTCATCTCATCAATGCCGCAAAGTTGGATGAAGCTAACTTACCAAAAGAAATCAATCTGGTAGATGATTACTTTGAACTTGTTCAGCATGAGTACAAGAAATGGCAGGAAAACAGCGAGCAGGGGAGGAGAGAGGGGCACGCCCAGAATCCCATGGAACCTTCCGTGCCCCAGCTTTCTCTCATGGATGTAAAATGTGAAACGCCCAACTGCCCCTTCTTCATGTCTGTGAACACCCAGCCTTTATGCCATGAGTGCTCAGAGAGGCGGCAAAAGAATCAAAACAAACTCCCAAAGCTGAACTCCAAGCCGGGCCCTGAGGGGCTCCCTGGCATGGCGCTCGGGGCCTCTCGGGGAGAAGCCTATGAGCCCTTGGCGTGGAACCCTGAGGAGTCCACTGGGGGGCCTCATTCGGCCCCACCGACAGCACCCAGCCCTTTTCTGTTCAGTGAGACCACTGCCATGAAGTGCAGGAGCCCCGGCTGCCCCTTCACACTGAATGTGCAGCACAACGGATTTTGTGAACGTTGCCACAACGCCCGGCAACTTCACGCCAGCCACGCCCCAGACCACACAAGGCACTTGGATCCCGGGAAGTGCCAAGCCTGCCTCCAGGATGTTACCAGGACATTTAATGGGATCTGCAGTACTTGCTTCAAAAGGACTACAGCAGAGGCCTCCTCCAGCCTCAGCACCAGCCTCCCTCCTTCCTGTCACCAGCGTTCCAAGTCAGATCCCTCGCGGCTCGTCCGGAGCCCCTCCCCGCATTCTTGCCACAGAGCTGGAAACGACGCCCCTGCTGGCTGCCTGTCTCAAGCTGCACGGACTCCTGGGGACAGGACGGGGACGAGCAAGTGCAGAAAAGCCGGCTGCGTGTATTTTGGGACTCCAGAAAACAAGGGCTTTTGCACACTGTGTTTCATCGAGTACAGAGAAAACAAACATTTTGCTGCTGCCTCAGGGAAAGTCAGTCCCACAGCGTCCAGGTTCCAGAACACCATTCCGTGCCTGGGGAGGGAATGCGGCACCCTTGGAAGCACCATGTTTGAAGGATACTGCCAGAAGTGTTTCATTGAAGCTCAGAATCAGAGATTTCATGAGGCCAAAAGGACAGAAGAGCAACTGAGATCGAGCCAGCGCAGAGATGTGCCTCGAACCACACAAAGCACCTCAAGGCCCAAGTGCGCCCGGGCCTCCTGCAAGAACATCCTGGCCTGCCGCAGCGAGGAGCTCTGCATGGAGTGTCAGCATCCCAACCAGAGGATGGGCCCTGGGGCCCACCGGGGTGAGCCTGCCCCCGAAGACCCCCCCAAGCAGCGTTGCCGGGCCCCCGCCTGTGATCATTTTGGCAATGCCAAGTGCAACGGCTACTGCAACGAATGCTTTCAGTTCAAGCAGATGTATGGCTAA
• Sequence Length: 2373

• Vector: Please Inquire

NCBI and Uniprot Product Information

• NCBI GI #: 89365978
• NCBI GeneID: 7128
• Molecular Weight: 89,614 Da
• NCBI Official Full Name: Homo sapiens tumor necrosis factor, alpha-induced protein 3, mRNA
• NCBI Official Synonym Full Names: TNF alpha induced protein 3
• NCBI Official Symbol: TNFAIP3
• NCBI Official Synonym Symbols: A20; AISBL; OTUD7C; TNFA1P2
• NCBI Protein Information: tumor necrosis factor alpha-induced protein 3
• UniProt Protein Name: Tumor necrosis factor alpha-induced protein 3
• Protein Family: TNFAIP3-interacting protein
• UniProt Gene Name: TNFAIP3
• UniProt Synonym Gene Names: OTUD7C; TNF alpha-induced protein 3
• UniProt Entry Name: TNAP3_HUMAN

NCBI Description

This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

TNFAIP3: Ubiquitin-editing enzyme that contains both ubiquitin ligase and deubiquitinase activities. Involved in immune and inflammatory responses signaled by cytokines, such as TNF-alpha and IL-1 beta, or pathogens via Toll-like receptors (TLRs) through terminating NF-kappa-B activity. Essential component of a ubiquitin-editing protein complex, comprising also RNF11, ITCH and TAX1BP1, that ensures the transient nature of inflammatory signaling pathways. In cooperation with TAX1BP1 promotes disassembly of E2-E3 ubiquitin protein ligase complexes in IL-1R and TNFR-1 pathways; affected are at least E3 ligases TRAF6, TRAF2 and BIRC2, and E2 ubiquitin-conjugating enzymes UBE2N and UBE2D3. In cooperation with TAX1BP1 promotes ubiquitination of UBE2N and proteasomal degradation of UBE2N and UBE2D3. Upon TNF stimulation, deubiquitinates 'Lys-63'-polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteasomal degradation and consequently termination of the TNF- or LPS-mediated activation of NF-kappa-B. Deubiquinates TRAF6 probably acting on 'Lys-63'-linked polyubiquitin. Upon T-cell receptor (TCR)-mediated T-cell activation, deubiquitinates 'Lys-63'-polyubiquitin chains on MALT1 thereby mediating disassociation of the CBM (CARD11:BCL10:MALT1) and IKK complexes and preventing sustained IKK activation. Deubiquinates NEMO/IKBKG; the function is facilitated by TNIP1 and leads to inhibition of NF-kappa-B activation. Upon stimulation by bacterial peptidoglycans, probably deubiquitinates RIPK2. Can also inhibit I-kappa-B-kinase (IKK) through a non-catalytic mechanism which involves polyubiquitin; polyubiquitin promotes association with IKBKG and prevents IKK MAP3K7-mediated phosphorylation. Targets TRAF2 for lysosomal degradation. In vitro able to deubiquitinate both 'Lys-48'- and 'Lys-63' polyubiquitin chains. Inhibitor of programmed cell death. Has a role in the function of the lymphoid system. Homodimer. Interacts with TNIP1, TAX1BP1 and TRAF2. Interacts with RNF11, ITCH and TAX1BP1 only after TNF stimulation; these interaction are transient and they are lost after 1 hour of stimulation with TNF. Interacts with YWHAZ and YWHAH. Interacts with IKBKG; the interaction is induced by TNF stimulation and by polyubiquitin. Interacts with RIPK1. Interacts with UBE2N; the interaction requires TAX1BP1. Interacts with TRAF6; the interaction is inhibited by HTLV-1 protein Tax. By TNF. Belongs to the peptidase C64 family.

Protein type: Ubiquitin conjugating system; Apoptosis; Protease; EC 3.4.19.12

Chromosomal Location of Human Ortholog: 6q23

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protease binding; protein binding; protein self-association; ubiquitin binding; ubiquitin-protein ligase activity; ubiquitin-specific protease activity

Biological Process: B-1 B cell homeostasis; inhibition of NF-kappaB transcription factor; negative regulation of B cell activation; negative regulation of I-kappaB kinase/NF-kappaB cascade; negative regulation of inflammatory response; negative regulation of innate immune response; negative regulation of interferon type I production; negative regulation of interleukin-2 production; negative regulation of interleukin-6 production; negative regulation of protein ubiquitination; negative regulation of smooth muscle cell proliferation; negative regulation of toll-like receptor 3 signaling pathway; negative regulation of tumor necrosis factor production; positive regulation of protein catabolic process; protein deubiquitination; regulation of germinal center formation; regulation of inflammatory response; response to molecule of bacterial origin

Disease: Autoinflammatory Syndrome, Familial, Behcet-like