Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CADM1 cdna clone

CADM1 cDNA Clone

Gene Names
CADM1; BL2; ST17; IGSF4; NECL2; RA175; TSLC1; IGSF4A; Necl-2; SYNCAM; sgIGSF; sTSLC-1; synCAM1
Synonyms
CADM1; CADM1 cDNA Clone; CADM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgagtgtagtgctgccgagcggatcccagtgtgcggcggcagcggcggcggcggcgcctcccgggctccggctccggcttctgctgttgctcttctccgccgcggcactgatccccacaggtgatgggcagaatctgtttacgaaagacgtgacagtgatcgagggagaggttgcgaccatcagttgccaagtcaataagagtgacgactctgtgattcagctactgaatcccaacaggcagaccatttatttcagggacttcaggcctttgaaggacagcaggtttcagttgctgaatttttctagcagtgaactcaaagtatcattgacaaacgtctcaatttctgatgaaggaagatacttttgccagctctataccgatcccccacaggaaagttacaccaccatcacagtcctggtcccaccacgtaatctgatgatcgatatccagaaagacactgcggtggaaggtgaggagattgaagtcaactgcactgctatggccagcaagccagccacgactatcaggtggttcaaagggaacacagagctaaaaggcaaatcggaggtggaagagtggtcagacatgtacactgtgaccagtcagctgatgctgaaggtgcacaaggaggacgatggggtcccagtgatctgccaggtggagcaccctgcggtcactggaaacctgcagacccagcggtatctagaagtacagtataagcctcaagtgcacattcagatgacttatcctctacaaggcttaacccgggaaggggacgcgcttgagttaacatgtgaagccatcgggaagccccagcctgtgatggtaacttgggtgagagtcgatgatgaaatgcctcaacacgccgtactgtctgggcccaacctgttcatcaataacctaaacaaaacagataatggtacataccgctgtgaagcttcaaacatagtggggaaagctcactcggattatatgctgtatgtatacgattcccgagcaggtgaagaaggctcgatcagggcagtggatcatgccgtgatcggtggcgtcgtggcggtggtggtgttcgccatgctgtgcttgctcatcattctggggcgctattttgccagacataaaggcctgttttctctaacctcctctcccagaataaagtga
Sequence Length
1164
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,624 Da
NCBI Official Full Name
Homo sapiens cell adhesion molecule 1, mRNA
NCBI Official Synonym Full Names
cell adhesion molecule 1
NCBI Official Symbol
CADM1
NCBI Official Synonym Symbols
BL2; ST17; IGSF4; NECL2; RA175; TSLC1; IGSF4A; Necl-2; SYNCAM; sgIGSF; sTSLC-1; synCAM1
NCBI Protein Information
cell adhesion molecule 1
UniProt Protein Name
Cell adhesion molecule 1
Protein Family
UniProt Gene Name
CADM1
UniProt Synonym Gene Names
IgSF4; NECL-2; SgIgSF; SynCAM; TSLC-1
UniProt Entry Name
CADM1_HUMAN

Uniprot Description

CADM1: a single-pass type I membrane protein that ediates homophilic cell-cell adhesion, and heterophilic cell-cell adhesion with CADM3 and PVRL3 in a Ca(2+)-independent manner. Acts as a tumor suppressor in non-small-cell lung cancer (NSCLC) cells. Interaction with CRTAM promotes natural killer (NK) cell cytotoxicity and interferon-gamma (IFN-gamma) secretion by CD8+ cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM3 in vivo. May contribute to the less invasive phenotypes of lepidic growth tumor cells. In mast cells, may mediate attachment to and promote communication with nerves. CADM1, together with MITF, is essential for development and survival of mast cells in vivo. May act as a synaptic cell adhesion molecule that drives synapse assembly. May be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. May play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. Belongs to the nectin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; Cell adhesion; Vesicle; Membrane protein, integral; Tumor suppressor

Chromosomal Location of Human Ortholog: 11q23.2

Cellular Component: basolateral plasma membrane; cell-cell adherens junction; integral to plasma membrane; intercellular junction; plasma membrane

Molecular Function: cell adhesion molecule binding; PDZ domain binding; protein binding; protein homodimerization activity; receptor activity; receptor binding

Biological Process: activated T cell proliferation; cell recognition; detection of stimulus; heterophilic cell adhesion; homophilic cell adhesion; positive regulation of cytokine secretion; positive regulation of natural killer cell mediated cytotoxicity; susceptibility to natural killer cell mediated cytotoxicity; T cell mediated cytotoxicity

Research Articles on CADM1

Similar Products

Product Notes

The CADM1 cadm1 (Catalog #AAA1278658) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgagtg tagtgctgcc gagcggatcc cagtgtgcgg cggcagcggc ggcggcggcg cctcccgggc tccggctccg gcttctgctg ttgctcttct ccgccgcggc actgatcccc acaggtgatg ggcagaatct gtttacgaaa gacgtgacag tgatcgaggg agaggttgcg accatcagtt gccaagtcaa taagagtgac gactctgtga ttcagctact gaatcccaac aggcagacca tttatttcag ggacttcagg cctttgaagg acagcaggtt tcagttgctg aatttttcta gcagtgaact caaagtatca ttgacaaacg tctcaatttc tgatgaagga agatactttt gccagctcta taccgatccc ccacaggaaa gttacaccac catcacagtc ctggtcccac cacgtaatct gatgatcgat atccagaaag acactgcggt ggaaggtgag gagattgaag tcaactgcac tgctatggcc agcaagccag ccacgactat caggtggttc aaagggaaca cagagctaaa aggcaaatcg gaggtggaag agtggtcaga catgtacact gtgaccagtc agctgatgct gaaggtgcac aaggaggacg atggggtccc agtgatctgc caggtggagc accctgcggt cactggaaac ctgcagaccc agcggtatct agaagtacag tataagcctc aagtgcacat tcagatgact tatcctctac aaggcttaac ccgggaaggg gacgcgcttg agttaacatg tgaagccatc gggaagcccc agcctgtgat ggtaacttgg gtgagagtcg atgatgaaat gcctcaacac gccgtactgt ctgggcccaa cctgttcatc aataacctaa acaaaacaga taatggtaca taccgctgtg aagcttcaaa catagtgggg aaagctcact cggattatat gctgtatgta tacgattccc gagcaggtga agaaggctcg atcagggcag tggatcatgc cgtgatcggt ggcgtcgtgg cggtggtggt gttcgccatg ctgtgcttgc tcatcattct ggggcgctat tttgccagac ataaaggcct gttttctcta acctcctctc ccagaataaa gtga. It is sometimes possible for the material contained within the vial of "CADM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.